View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20777_high_17 (Length: 248)
Name: NF20777_high_17
Description: NF20777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20777_high_17 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 232
Target Start/End: Complemental strand, 40060626 - 40060394
Alignment:
| Q |
1 |
atcatgctattttgtttgtttaaaatatttcattgaaccattttccttatgtctacctcgtttggaaatgtgtgcctttgtcttgaaatttt-atggtgg |
99 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
40060626 |
atcatgctattttgtttgtttaaaaaatttcattgaaccattttccttatgtcttcctggtttggaaatgtgtgcctttgccttgaaattttgatggtgg |
40060527 |
T |
 |
| Q |
100 |
ataggtttttggatttggatgtcccactgtttttcatatattttccattcttaaaccatatgttgatgttgtggtcctaaatgtccctttatgctgaatt |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40060526 |
ataggtttttggatttggatgtcccactgtttttcatatattttccattcttaaaccatatgttgatgttgtggtcctaaatgtccctttatgctgaatt |
40060427 |
T |
 |
| Q |
200 |
caccactatagtgtagcatgctttggtataaac |
232 |
Q |
| |
|
|||||||||||||||||||||||| | |||||| |
|
|
| T |
40060426 |
caccactatagtgtagcatgcttttgcataaac |
40060394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University