View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20777_low_13 (Length: 304)
Name: NF20777_low_13
Description: NF20777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20777_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 17 - 287
Target Start/End: Complemental strand, 44730522 - 44730236
Alignment:
| Q |
17 |
atgaaggatactgatccaattataaagtcaaaaattggttaagtagtgtacttgtcgtagttgtaactcatgtcatagccaacaaccgagccaaatcaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44730522 |
atgaaggatactgatccaattataaagtcaaaaattggttaagtagtgtacttgttgtagttgtaactcatgtcatagccaacaaccgagccaaatcaaa |
44730423 |
T |
 |
| Q |
117 |
actaccaagtccaccattatattcttcacaagatggagcggtttaacaaacatcacttctcattgcatacattaccttgtttt----------------a |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
44730422 |
actaccaagtccaccattatattcttcacaagatggagcggtttaacaaacatcacttctcattgcatacattaccttgttttacacaccttttgtctca |
44730323 |
T |
 |
| Q |
201 |
catcaacaccttgtattgactcataacaatatcctcttatgggaaaccatatctcatttcatgccacaaccaaaatcatttactatg |
287 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44730322 |
catcaacaccttgtattggctcataacaatatcctcttatgggaaaccatatctcatttcatgccacaaccaaaatcatttactatg |
44730236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University