View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20777_low_19 (Length: 246)
Name: NF20777_low_19
Description: NF20777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20777_low_19 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 158; Significance: 3e-84; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 51 - 234
Target Start/End: Original strand, 8794542 - 8794722
Alignment:
| Q |
51 |
ttcaaataaagtaaggtaacaacaagcacaacaaatgaacaaaaccataaaacacacaatgggagcttgaatgagaaaaataacaatgattacatacttg |
150 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8794542 |
ttcaaataaagtaaggtaacaacaagcacaacaaatgaacaaaaccctaaaacacacaatgggagcttgaatgagaaaaataacaatgattacatacttg |
8794641 |
T |
 |
| Q |
151 |
aacaatattcttcatcctctttccaccataaagatgtatatgggttctctttggtttcacaatcctttctcgatcacttccccc |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
8794642 |
aacaatattcttcatcctctttccaccataaagatgtatatggg---tctctggtttcgcaatcctttctcgatcacttccccc |
8794722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 32
Target Start/End: Original strand, 8794494 - 8794525
Alignment:
| Q |
1 |
gcataagaaactttgcaattataaatcagcat |
32 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
8794494 |
gcataagaaactttgcaattataaatcagcat |
8794525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University