View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20777_low_20 (Length: 243)

Name: NF20777_low_20
Description: NF20777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20777_low_20
NF20777_low_20
[»] chr3 (2 HSPs)
chr3 (1-94)||(51963758-51963851)
chr3 (161-224)||(51963628-51963691)


Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 51963851 - 51963758
Alignment:
1 tttactattaaaccaaaattcagcataatttctttgctgctatagttattctcattgctttattcgtttcaaagaaaggtttaaaataatattg 94  Q
    |||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
51963851 tttactattaaaccaaaattcagcataacttttttgctgctataattattctcattgctttattcgtttcaaagaaaggtttaaaataatattg 51963758  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 161 - 224
Target Start/End: Complemental strand, 51963691 - 51963628
Alignment:
161 atattgatccaacttactaacacactgtatttcactcacttcattaatagtgtctattgtgaac 224  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
51963691 atattgatccaacttactaacacactgtatttcactcacttcattaatagtgtctattgtgaac 51963628  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University