View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20777_low_20 (Length: 243)
Name: NF20777_low_20
Description: NF20777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20777_low_20 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 82; Significance: 8e-39; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 1 - 94
Target Start/End: Complemental strand, 51963851 - 51963758
Alignment:
| Q |
1 |
tttactattaaaccaaaattcagcataatttctttgctgctatagttattctcattgctttattcgtttcaaagaaaggtttaaaataatattg |
94 |
Q |
| |
|
|||||||||||||||||||||||||||| || |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51963851 |
tttactattaaaccaaaattcagcataacttttttgctgctataattattctcattgctttattcgtttcaaagaaaggtttaaaataatattg |
51963758 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 161 - 224
Target Start/End: Complemental strand, 51963691 - 51963628
Alignment:
| Q |
161 |
atattgatccaacttactaacacactgtatttcactcacttcattaatagtgtctattgtgaac |
224 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51963691 |
atattgatccaacttactaacacactgtatttcactcacttcattaatagtgtctattgtgaac |
51963628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University