View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20778_low_2 (Length: 236)
Name: NF20778_low_2
Description: NF20778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20778_low_2 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 155; Significance: 2e-82; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 16 - 186
Target Start/End: Complemental strand, 33743630 - 33743460
Alignment:
| Q |
16 |
cgagtgagatgaagaagaggaggattgttgatgctaatgctgtttttgatttgttgccaactggatggaagcttgtgcttattgtgcagaggagaggaaa |
115 |
Q |
| |
|
||||||| | |||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33743630 |
cgagtgataggaagaagaggaggattgttgatgccaatgctgtttgtgatttgttgccaactggatggaagcttgtgcttattgtgcagaggagaggaaa |
33743531 |
T |
|
| Q |
116 |
gcataattctgtggtttgtcgccgttacacaaggtttatactctttctcattgccttcaattgtccttttt |
186 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33743530 |
gcataattctgtggtttgtcgccgttacacaaggtttatactctttctcattgccttcaattgtccttttt |
33743460 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 70; Significance: 1e-31; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 16 - 125
Target Start/End: Complemental strand, 27903898 - 27903789
Alignment:
| Q |
16 |
cgagtgagatgaagaagaggaggattgttgatgctaatgctgtttttgatttgttgccaactggatggaagcttgtgcttattgtgcagaggagaggaaa |
115 |
Q |
| |
|
||||||| | ||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||||||||| |||||||| || |||||||||| || |
|
|
| T |
27903898 |
cgagtgataggaagaagaggaggattgttgatgctaatgttgtttgtgatttgttgccaactgcatggaagctagtgcttatagtatagaggagagggaa |
27903799 |
T |
|
| Q |
116 |
gcataattct |
125 |
Q |
| |
|
|||||||||| |
|
|
| T |
27903798 |
gcataattct |
27903789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 26 - 97
Target Start/End: Original strand, 27903712 - 27903783
Alignment:
| Q |
26 |
gaagaagaggaggattgttgatgctaatgctgtttttgatttgttgccaactggatggaagcttgtgcttat |
97 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||| |||||||||| |||||||||||||||| ||| |||| |
|
|
| T |
27903712 |
gaagaagaggaggatggttgatgctaatgttgtttgtgatttgttgtcaactggatggaagctagtgattat |
27903783 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University