View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20779_high_24 (Length: 206)

Name: NF20779_high_24
Description: NF20779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20779_high_24
NF20779_high_24
[»] chr4 (1 HSPs)
chr4 (7-184)||(8672280-8672456)
[»] chr8 (2 HSPs)
chr8 (101-141)||(23344724-23344765)
chr8 (101-141)||(23382270-23382311)


Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 7 - 184
Target Start/End: Original strand, 8672280 - 8672456
Alignment:
7 ggagcagagacggtcgaaatatgatttagtgtttggggagaatnnnnnnnntggcatgaacacaaccaatcaaatgtggttttcgatctttgtagattta 106  Q
    |||| ||||||||||||||||||||||||||||||||||||||        ||||||| ||||||||||||||| |||||||| ||||||||||||||||    
8672280 ggaggagagacggtcgaaatatgatttagtgtttggggagaataaaaaaa-tggcatgcacacaaccaatcaaacgtggtttttgatctttgtagattta 8672378  T
107 atttacgattttctattgagttggttcagttttaatttatacgcatctatataataatgtgtaatcagattatgaggc 184  Q
     |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
8672379 gtttacgattttccattgagttggttcagttttaatttatacgcatctatataataacgtgtaatcagattatgaggc 8672456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 34; Significance: 0.0000000003; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 101 - 141
Target Start/End: Complemental strand, 23344765 - 23344724
Alignment:
101 gatttaatttacgatttt-ctattgagttggttcagttttaa 141  Q
    |||||||||||||||||| |||||||||||||||||||||||    
23344765 gatttaatttacgatttttctattgagttggttcagttttaa 23344724  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 101 - 141
Target Start/End: Original strand, 23382270 - 23382311
Alignment:
101 gatttaatttacga-ttttctattgagttggttcagttttaa 141  Q
    |||||||||||||| |||||||||||||||||||||||||||    
23382270 gatttaatttacgacttttctattgagttggttcagttttaa 23382311  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University