View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20779_low_16 (Length: 261)
Name: NF20779_low_16
Description: NF20779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20779_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 141 - 247
Target Start/End: Complemental strand, 44193394 - 44193288
Alignment:
| Q |
141 |
aggaagagggtttatggcagaatctcaattcttcacaagaaggtgccaatgaagatgtgaaggtgagttctatttttacatatataatttaattttagaa |
240 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44193394 |
aggaagagggtttatggcagaatctcaattcttcacaagaaggtgccaatgaagatgtgaaggtgagttctatttttacatatataatttaattttagaa |
44193295 |
T |
 |
| Q |
241 |
gtataat |
247 |
Q |
| |
|
||||||| |
|
|
| T |
44193294 |
gtataat |
44193288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 19 - 67
Target Start/End: Complemental strand, 44193515 - 44193467
Alignment:
| Q |
19 |
ctctacaggagcttaaggtaatttcaaatttttgggattcagttccttc |
67 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
44193515 |
ctctacaggagcttaaggtaatttcaattttttgggattcagttccttc |
44193467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University