View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2077_low_2 (Length: 397)

Name: NF2077_low_2
Description: NF2077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2077_low_2
NF2077_low_2
[»] chr4 (7 HSPs)
chr4 (19-373)||(24860293-24860647)
chr4 (30-373)||(34748502-34748845)
chr4 (125-176)||(44771102-44771153)
chr4 (24-136)||(53290720-53290832)
chr4 (306-374)||(40044756-40044824)
chr4 (19-94)||(40036062-40036137)
chr4 (19-94)||(40045370-40045445)
[»] chr7 (3 HSPs)
chr7 (19-373)||(21317321-21317675)
chr7 (19-373)||(3929988-3930342)
chr7 (19-241)||(3928636-3928858)
[»] scaffold0197 (1 HSPs)
scaffold0197 (19-373)||(30759-31112)
[»] chr5 (7 HSPs)
chr5 (19-373)||(12531239-12531593)
chr5 (19-373)||(12547026-12547380)
chr5 (19-372)||(9866684-9867038)
chr5 (19-98)||(9870003-9870082)
chr5 (19-121)||(9894642-9894744)
chr5 (19-136)||(38735501-38735618)
chr5 (189-269)||(9869866-9869946)
[»] chr2 (6 HSPs)
chr2 (19-373)||(13576095-13576449)
chr2 (128-373)||(34579050-34579295)
chr2 (128-373)||(34584799-34585044)
chr2 (114-187)||(34571568-34571641)
chr2 (317-373)||(34571801-34571857)
chr2 (317-373)||(34562977-34563033)
[»] chr8 (7 HSPs)
chr8 (26-373)||(26591915-26592262)
chr8 (19-373)||(43479701-43480055)
chr8 (19-383)||(38799232-38799596)
chr8 (19-383)||(38821921-38822285)
chr8 (24-373)||(25865447-25865796)
chr8 (19-373)||(41943691-41944045)
chr8 (24-97)||(44343978-44344051)
[»] chr3 (1 HSPs)
chr3 (66-142)||(27440875-27440951)
[»] chr1 (4 HSPs)
chr1 (66-142)||(17769236-17769312)
chr1 (135-220)||(7594402-7594487)
chr1 (312-373)||(7594916-7594977)
chr1 (135-187)||(18492741-18492793)


Alignment Details
Target: chr4 (Bit Score: 323; Significance: 0; HSPs: 7)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 323; E-Value: 0
Query Start/End: Original strand, 19 - 373
Target Start/End: Complemental strand, 24860647 - 24860293
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||||||||||||||||||||||||||| || ||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
24860647 taactctcttagcatgaatagcgcaaagatttgtatcttcaaagagtccaacgagataagcttcagcagcttcttgaagagcagaaacagcgctactctg 24860548  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24860547 gaaacggagatcggttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 24860448  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
24860447 atttcgcgaagtgcaacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 24860348  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    ||||||||||||||||||||||||||||||||||||||||||| ||||| |||||    
24860347 tccttggtgcttttcctccggtggatttgcgagctgtttgctttgtacgagccat 24860293  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 30 - 373
Target Start/End: Complemental strand, 34748845 - 34748502
Alignment:
30 gcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctggaaacggagat 129  Q
    |||||||| || || |||||||||||||||||||| |||||||||||||| ||||| |||||||| || || || || |||   ||||||||||||||||    
34748845 gcatgaatggcacagaggttagtatcctcaaagagaccaacgagataagcctcagccgcttcttgcagcgccgacacggcggagctctggaaacggagat 34748746  T
130 ctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggatttcgcgaag 229  Q
    | || |||||||| |||||||| |||||||| ||||| ||||| || ||||| |||||||| || || ||||| || |||||||| ||||| || || ||    
34748745 cagtcttgaaatcctgagcgatctcacgaaccagacgctggaaggggagtttgcggatgaggagttcggtgctcttctggtacttacggatctcacgtag 34748646  T
230 tgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtgct 329  Q
     ||||||||||| || | |||||||||||||||||||||||| |||||||| ||||| ||||| || ||||||||||| ||||| ||||||||||| |||    
34748645 agcgacggttcctggtctgaaacggtgaggtttcttcactccaccggtggccggagcagatttgcgagcggcttttgtggctagttgcttccttggagct 34748546  T
330 tttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    || ||||| |||||||||||||| ||||||||||||||||||||    
34748545 ttacctccagtggatttgcgagcggtttgcttggtacgtgccat 34748502  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 176
Target Start/End: Original strand, 44771102 - 44771153
Alignment:
125 gagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatgga 176  Q
    |||||| ||||||||||| ||||||||||||||||| |||||||||||||||    
44771102 gagatcggttttgaaatcctgagcgatttcacgaacaagacgttggaatgga 44771153  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #4
Raw Score: 37; E-Value: 0.000000000009
Query Start/End: Original strand, 24 - 136
Target Start/End: Complemental strand, 53290832 - 53290720
Alignment:
24 ctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctggaaac 123  Q
    |||||||||||||| |  |||||||||||||| ||||| |  ||||| |||||||||||| |  ||| ||||||||| |||||| || | || ||||| |    
53290832 ctcttagcatgaatggtacaaaggttagtatcttcaaacaaaccaacaagataagcttcaacgactttttgaagagcagaaacaacgttgctatggaacc 53290733  T
124 ggagatctgtttt 136  Q
     ||||||||||||    
53290732 tgagatctgtttt 53290720  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 306 - 374
Target Start/End: Complemental strand, 40044824 - 40044756
Alignment:
306 gttgctagctgcttccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccatc 374  Q
    ||||| || |||||||||||||| ||||| || || || || ||||| |||||||||||||||||||||    
40044824 gttgcaagttgcttccttggtgcctttccacctgttgacttacgagcagtttgcttggtacgtgccatc 40044756  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #6
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 40036137 - 40036062
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttg 94  Q
    |||||| ||| ||||| ||||| || | |||||| ||||||||||| ||||| ||||| ||||||||||| |||||    
40036137 taactcgcttggcatggatagcacacaagttagtgtcctcaaagagaccaacaagatatgcttcagcagcctcttg 40036062  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #7
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 19 - 94
Target Start/End: Complemental strand, 40045445 - 40045370
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttg 94  Q
    |||||| ||| ||||| |||||||| | |||||| ||||||||||| ||||| ||||| || |||||||| |||||    
40045445 taactcgcttggcatggatagcgcacaagttagtgtcctcaaagagaccaacaagatatgcctcagcagcctcttg 40045370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 183; Significance: 7e-99; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 183; E-Value: 7e-99
Query Start/End: Original strand, 19 - 373
Target Start/End: Complemental strand, 21317675 - 21317321
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||||||||||||||||||||||||||| || ||||| ||||| |  ||||| |||||||||||||| |||||||||||||| |||||||| || |||||    
21317675 taactctcttagcatgaatagcgcaaagatttgtatcttcaaacaaaccaacaagataagcttcagccgcttcttgaagagcagaaacagcactgctctg 21317576  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| | |||||| ||||||||||| ||||||||||||||||| ||||||||||||||||||||||  || |||||||| ||||| || ||||||||||||    
21317575 gaatctgagatcggttttgaaatcctgagcgatttcacgaacaagacgttggaatggaagttttcttatcagaagctcagtgctcttctggtacttgcgg 21317476  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    ||||| ||||| || ||||||||||||||||||||||| || ||||||||||| ||||| || ||||| |||||||| |||||||| || || || || |    
21317475 atttcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtt 21317376  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    | | ||| |||||||| |||||||||||||| |||||||| ||||||||||||||    
21317375 tgcgtggggcttttccgccggtggatttgcgtgctgtttgtttggtacgtgccat 21317321  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 131; E-Value: 7e-68
Query Start/End: Original strand, 19 - 373
Target Start/End: Original strand, 3929988 - 3930342
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    ||||||||||||||||||| || ||||| || ||||| ||||| |  ||||| ||||| ||||||||||||||||||||||| |||||||| ||||||||    
3929988 taactctcttagcatgaatggcacaaagattcgtatcttcaaacaaaccaacaagatacgcttcagcagcttcttgaagagcagaaacagcactactctg 3930087  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
     || || ||||| ||||||||||| ||||||||||||||||| |  | ||||||||||||||| |  |||||||| || ||||| || || |||||||||    
3930088 aaatcgaagatcagttttgaaatcctgagcgatttcacgaaccaatctttggaatggaagtttcctaatgagaagttcagtgctcttctgatacttgcgg 3930187  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    || || ||||||||||| ||||| |||||||| | ||| |||||||| || || ||||| || || || ||||| |  |||||||| || || || || |    
3930188 atctcacgaagtgcgactgttcctggacggaatctgtgtggtttctttacaccaccggttgccggtgctgattttcttgcggctttggtggcgagttgtt 3930287  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    ||| ||| |||||||||||||||||||| || |||||||| ||||||||||||||    
3930288 tccgtggggcttttcctccggtggattttcgtgctgtttgtttggtacgtgccat 3930342  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 59; E-Value: 7e-25
Query Start/End: Original strand, 19 - 241
Target Start/End: Original strand, 3928636 - 3928858
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||||||||||||||||||||| ||||| ||  |||| ||||| |  ||||| | | | ||||||||   |||||||||||| |||||||||||  ||||    
3928636 taactctcttagcatgaatagcacaaagattcatatcttcaaacaaaccaacaatacacgcttcagcgatttcttgaagagcagaaacagcgctgatctg 3928735  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| |||||||| ||||||||||| |||||||||||| |||| |  | || ||| |||||||| |  ||||||||||| ||| | ||||| ||||| | |    
3928736 gaatcggagatcagttttgaaatcctgagcgatttcatgaaccaatcttttgaaaggaagtttcctaatgagaagctcagtgatcttttgatacttcctg 3928835  T
219 atttcgcgaagtgcgacggttcc 241  Q
    ||||| || | |||||| |||||    
3928836 atttcacgcaatgcgactgttcc 3928858  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0197 (Bit Score: 175; Significance: 4e-94; HSPs: 1)
Name: scaffold0197
Description:

Target: scaffold0197; HSP #1
Raw Score: 175; E-Value: 4e-94
Query Start/End: Original strand, 19 - 373
Target Start/End: Complemental strand, 31112 - 30759
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||||||||||||||||||||||||||| || ||||| ||||| |  ||||| ||||||||||||||||||||||||||||| |||||||| || |||||    
31112 taactctcttagcatgaatagcgcaaagatttgtatcttcaaacaaaccaacaagataagcttcagcagcttcttgaagagcagaaacagcactgctctg 31013  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| | |||||  ||||||||||| ||||||||||||||||| |||||||||||| |||||||||  || |||||||| ||||| || ||||||||||||    
31012 gaatctgagataggttttgaaatcctgagcgatttcacgaacaagacgttggaat-gaagttttcttatcagaagctcagtgctcttctggtacttgcgg 30914  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    ||||| ||||| || ||||||||||||||||||||||| || ||||||||||| ||||| || ||||| |||||||| |||||||| || || || || |    
30913 atttcacgaagcgccacggttccgggacggaaacggtgtggcttcttcactcctccggtcgccggagctgatttccgtgcggctttggtggcgagttgtt 30814  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    | | ||| |||||||| |||||||||||||| |||||||| ||||||||||||||    
30813 tgcgtggggcttttccgccggtggatttgcgtgctgtttgtttggtacgtgccat 30759  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 167; Significance: 2e-89; HSPs: 7)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 373
Target Start/End: Complemental strand, 12531593 - 12531239
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||| |||||||||||||| || || || |||||||| ||||| |  ||||| ||||||||||||||||||||||||||||| |||||||| || || ||    
12531593 taaccctcttagcatgaatggcacagagattagtatcttcaaacaaaccaacaagataagcttcagcagcttcttgaagagcagaaacagcactgctttg 12531494  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| |||||||||||||||||||||||||||||||||||||| || |  ||||||||||| || |  || |||||||| ||||| || ||||||||||||    
12531493 gaatcggagatctgttttgaaatcttgagcgatttcacgaacaagcctctggaatggaagcttccttataagaagctcggtgctcttctggtacttgcgg 12531394  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    || || |||||||| || ||||| |||||||| | ||| || ||||| ||||| ||||| || ||||| ||||||||||| ||||| || || |||||||    
12531393 atctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgct 12531294  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
12531293 tccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 12531239  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 373
Target Start/End: Original strand, 12547026 - 12547380
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||| |||||||||||||| || || || |||||||| ||||| |  ||||| ||||||||||||||||||||||||||||| |||||||| || || ||    
12547026 taaccctcttagcatgaatggcacagagattagtatcttcaaacaaaccaacaagataagcttcagcagcttcttgaagagcagaaacagcactgctttg 12547125  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| |||||||||||||||||||||||||||||||||||||| || |  ||||||||||| || |  || |||||||| ||||| || ||||||||||||    
12547126 gaatcggagatctgttttgaaatcttgagcgatttcacgaacaagcctctggaatggaagcttccttataagaagctcggtgctcttctggtacttgcgg 12547225  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    || || |||||||| || ||||| |||||||| | ||| || ||||| ||||| ||||| || ||||| ||||||||||| ||||| || || |||||||    
12547226 atctcacgaagtgcaacagttcctggacggaatctgtgtggcttcttgactcctccggttgccggagcagatttccgggcagctttagtggcaagctgct 12547325  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    |||||||||||||||| |||||||||||||||||||||||||||||||| |||||    
12547326 tccttggtgcttttccgccggtggatttgcgagctgtttgcttggtacgagccat 12547380  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 19 - 372
Target Start/End: Original strand, 9866684 - 9867038
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||||||||||||||||||||| |||||||||||||| ||||| |  ||||| |||||  ||| |||||||||||||||||| |||||| | |||||||     
9866684 taactctcttagcatgaatagcacaaaggttagtatcttcaaacaaaccaacaagatagtctttagcagcttcttgaagagcagaaacatcactactcta 9866783  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacga-acgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtact--tg 215  Q
    ||| |  ||||| || |||||||| |  ||| || |   | |  || |  || || ||||| || |  |  ||||||||  |||| ||||||||||  |     
9866784 gaacctcagatcagtcttgaaatccttcgcgtttccctcagatcagtctctgaaacggaagcttcctta--agaagctcaatgctcttttggtactctta 9866881  T
216 cggatttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagct 315  Q
    ||||| || ||||| || |||||||| |||||||||||||| || ||||||||||| || || || ||||| |||||||| || |||||||| || ||||    
9866882 cggatctcacgaagcgcaacggttccaggacggaaacggtgtggcttcttcactcctcccgttgccggagctgatttccgagcagcttttgtggccagct 9866981  T
316 gcttccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgcca 372  Q
     ||| | ||||||||| || ||||||||||||||||| ||||| ||||||| |||||    
9866982 tctttcatggtgctttaccgccggtggatttgcgagccgtttgtttggtacatgcca 9867038  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #4
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 98
Target Start/End: Complemental strand, 9870082 - 9870003
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaaga 98  Q
    |||||||||||||||||||||||||||| ||| |||| | ||| |  ||||| | |||||||||| ||||||||||||||    
9870082 taactctcttagcatgaatagcgcaaagattaatatcttaaaacaaaccaacaaaataagcttcaacagcttcttgaaga 9870003  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #5
Raw Score: 39; E-Value: 0.0000000000006
Query Start/End: Original strand, 19 - 121
Target Start/End: Complemental strand, 9894744 - 9894642
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||||| ||||||||||||||||||||  |||||||| ||||| |  | ||| | | |||||||| || ||||||||| ||| |||||||| ||||||||    
9894744 taactcacttagcatgaatagcgcaaatattagtatcttcaaacaaactaacaaaacaagcttcaacaacttcttgaacagcagaaacagcactactctg 9894645  T
119 gaa 121  Q
    |||    
9894644 gaa 9894642  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #6
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 19 - 136
Target Start/End: Complemental strand, 38735618 - 38735501
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||| ||||||||||||||||  |||||||||||||| ||||| |  ||||| |||||| |||||    ||| ||||||||| ||||||||| | || ||    
38735618 taaccctcttagcatgaatagtacaaaggttagtatcttcaaacaaaccaacaagataaacttcaatgactttttgaagagcagaaacagcgttgctatg 38735519  T
119 gaaacggagatctgtttt 136  Q
    ||| | ||||||||||||    
38735518 gaacctgagatctgtttt 38735501  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #7
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 189 - 269
Target Start/End: Complemental strand, 9869946 - 9869866
Alignment:
189 agaagctctgtgcttttttggtacttgcggatttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcact 269  Q
    |||||||| ||||| || |||||||| ||||| || ||||| || ||||||||  ||| ||||| ||| ||||||||||||    
9869946 agaagctcagtgctcttctggtacttacggatctcacgaagagcaacggttccatgacagaaacagtgtggtttcttcact 9869866  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 167; Significance: 2e-89; HSPs: 6)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 167; E-Value: 2e-89
Query Start/End: Original strand, 19 - 373
Target Start/End: Complemental strand, 13576449 - 13576095
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||| ||||||||||||||||| ||||| || ||||||||||| |  ||||| ||||||||||||||||||||||||||||| |||||||| || || ||    
13576449 taaccctcttagcatgaatagcacaaagattcgtatcctcaaacaaaccaacaagataagcttcagcagcttcttgaagagcagaaacagcactgctttg 13576350  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
     ||||||||||| ||||||||||| ||||| ||||| ||||| |  | |||||||||||| || |  ||||||||||| ||||| || || |||||||||    
13576349 aaaacggagatccgttttgaaatcctgagcaatttctcgaaccaatctttggaatggaagcttccttatgagaagctcggtgctcttctgatacttgcgg 13576250  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    ||||| ||||| ||||||||||| ||||||||||| || || ||||||||||| |||||||| |||||||||||||| ||||||||||| || || || |    
13576249 atttcacgaagagcgacggttccaggacggaaacgatgtggcttcttcactcctccggtggccggagcggatttccgagcggcttttgtggcgagttgtt 13576150  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    | | |||||||||||| |||||||||||||| |||||||| ||||||||||||||    
13576149 tgcgtggtgcttttccgccggtggatttgcgggctgtttgtttggtacgtgccat 13576095  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 128 - 373
Target Start/End: Original strand, 34579050 - 34579295
Alignment:
128 atctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggatttcgcga 227  Q
    |||||| |||||||  ||||| ||||||||||| ||||| |||||||||||||| || || | ||| || || |  || || ||||| || || || |||    
34579050 atctgtcttgaaattctgagcaatttcacgaacaagacgctggaatggaagtttacgaatcaaaagttcggtacccttctgatacttacgtatctcacga 34579149  T
228 agtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtg 327  Q
    || || || ||||| |||||  |||| ||||| ||||| | ||||||||| | |||  | ||||| || || || ||||| || || |||||||||||||    
34579150 agagcaactgttccaggacgataacgatgaggcttcttgattccgccggttgttggcacagattttcgagcagcctttgtggcgagttgcttccttggtg 34579249  T
328 cttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    | || ||   ||||||| ||||||| |||||||| ||||| |||||    
34579250 ccttaccaagggtggatctgcgagcagtttgctttgtacgcgccat 34579295  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 128 - 373
Target Start/End: Original strand, 34584799 - 34585044
Alignment:
128 atctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggatttcgcga 227  Q
    |||||| |||||||  ||||| ||||||||||| ||||| |||||||||||||| || || | ||| || || |  || || ||||| || || || |||    
34584799 atctgtcttgaaattctgagcaatttcacgaacaagacgctggaatggaagtttacgaatcaaaagttcggtacccttctgatacttacgtatctcacga 34584898  T
228 agtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttggtg 327  Q
    || || || ||||| |||||  |||| ||||| ||||| | ||||||||| | |||  | ||||| || || || ||||| || || |||||||||||||    
34584899 agagcaactgttccaggacgataacgatgaggcttcttgattccgccggttgttggcacagattttcgagcagcctttgtggcgagttgcttccttggtg 34584998  T
328 cttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    | || ||   ||||||| ||||||| |||||||| ||||| |||||    
34584999 ccttaccaagggtggatctgcgagcagtttgctttgtacgcgccat 34585044  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #4
Raw Score: 34; E-Value: 0.0000000006
Query Start/End: Original strand, 114 - 187
Target Start/End: Original strand, 34571568 - 34571641
Alignment:
114 ctctggaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggat 187  Q
    |||||||| || | ||| || |||||||| ||||| ||||||||||| ||||| |||||||||||||| |||||    
34571568 ctctggaatcgtaaatccgtcttgaaatcctgagcaatttcacgaacaagacgctggaatggaagtttacggat 34571641  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 317 - 373
Target Start/End: Original strand, 34571801 - 34571857
Alignment:
317 cttccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    |||||||||||| || || ||||||||||||||||| |||||||| ||||| |||||    
34571801 cttccttggtgccttgccaccggtggatttgcgagcagtttgctttgtacgcgccat 34571857  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #6
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 317 - 373
Target Start/End: Original strand, 34562977 - 34563033
Alignment:
317 cttccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    |||| ||||||| || || ||||||||||||||||| |||||||| ||||| |||||    
34562977 cttcgttggtgccttgccaccggtggatttgcgagcagtttgctttgtacgcgccat 34563033  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 156; Significance: 9e-83; HSPs: 7)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 156; E-Value: 9e-83
Query Start/End: Original strand, 26 - 373
Target Start/End: Complemental strand, 26592262 - 26591915
Alignment:
26 cttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctggaaacgg 125  Q
    |||||||||||||||||| ||||||||||||||||| | |||||| |||||||| || || |||||||| || || || |||||    ||||| ||||||    
26592262 cttagcatgaatagcgcagaggttagtatcctcaaacaatccaacaagataagcctccgccgcttcttgcagcgccgacacagcagagctctgaaaacgg 26592163  T
126 agatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggatttcgc 225  Q
    ||||| || |||||||| ||||| || |||||||| ||||| ||||| |||||||| || |||||||| || ||||| || |||||||||||||| || |    
26592162 agatccgtcttgaaatcctgagcaatctcacgaacaagacgctggaaaggaagtttgcgaatgagaagttcggtgctcttctggtacttgcggatctcac 26592063  T
226 gaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttccttgg 325  Q
    | |||||||||||||| || | ||||||||| || ||||||||||||||||| || |||||||||||||| |||||||||||||| ||||||||||||||    
26592062 ggagtgcgacggttcctggcctgaaacggtgtggcttcttcactccgccggtcgccggagcggatttccgagcggcttttgttgcgagctgcttccttgg 26591963  T
326 tgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    |||||| || |||||||| ||||| || |||||||| |||||||||||    
26591962 tgctttgccgccggtggacttgcgtgcagtttgcttagtacgtgccat 26591915  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 151; E-Value: 9e-80
Query Start/End: Original strand, 19 - 373
Target Start/End: Original strand, 43479701 - 43480055
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||| |||||||||||||||||||||||||||||||| ||||| |  ||||| |||||||||||||| |||||||||||||| |||||||||||||||||    
43479701 taaccctcttagcatgaatagcgcaaaggttagtatcttcaaacaaaccaacaagataagcttcagcggcttcttgaagagcagaaacagcgctactctg 43479800  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| | |||||| ||||||||||| ||||||||||| | ||| |  | |||||||||||| || | |||||||||||| || || || || |||||||||    
43479801 gaacctgagatcagttttgaaatcctgagcgatttccctaaccaatctttggaatggaagcttcctgatgagaagctcggtactcttctgatacttgcgg 43479900  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    || || ||||| || || ||||| |||||||| | ||| || ||||||||||| |||||||| ||||| |||||||| |||||||| || || || || |    
43479901 atctcacgaagagcaacagttccaggacggaatctgtgtggcttcttcactcctccggtggccggagctgatttccgagcggctttggtggcgagttgtt 43480000  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    ||||||| ||||| || ||||||||||||||||| ||||| |||||||| |||||    
43480001 tccttggagctttgccaccggtggatttgcgagcggtttgtttggtacgagccat 43480055  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 19 - 383
Target Start/End: Complemental strand, 38799596 - 38799232
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    ||||||||||||||||||| || |||||||| || || |||||||| ||||| |  |||||||||||||||||||||||||||||||| ||||| |||||    
38799596 taactctcttagcatgaattgcacaaaggtttgtgtcttcaaagagaccaaccaagtaagcttcagcagcttcttgaagagcggaaactgcgctgctctg 38799497  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| |  |||||||| |||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||| ||||| || || ||||| |||    
38799496 gaatctcagatctgtcttgaaatcttgagcaatttcacgaacaagacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacgg 38799397  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    || || |  |  || || ||||| || | ||| |  || || ||||||||||| ||||| || ||||| |||||||| ||||| || || || |||||||    
38799396 atctctctcaaagcaacagttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgct 38799297  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccatcgtgagagaa 383  Q
    |||  || || || || ||||||||||||||||||||||||||||||||||||||||||||||||    
38799296 tccggggagccttgccgccggtggatttgcgagctgtttgcttggtacgtgccatcgtgagagaa 38799232  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 149; E-Value: 1e-78
Query Start/End: Original strand, 19 - 383
Target Start/End: Original strand, 38821921 - 38822285
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    ||||||||||||||||||| || |||||||| || || |||||||| ||||| |  |||||||||||||||||||||||||||||||| ||||| |||||    
38821921 taactctcttagcatgaattgcacaaaggtttgtgtcttcaaagagaccaaccaagtaagcttcagcagcttcttgaagagcggaaactgcgctgctctg 38822020  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| |  |||||||| |||||||||||||| ||||||||||| |||||||||||||||||||| |||||||||||||| ||||| || || ||||| |||    
38822021 gaatctcagatctgtcttgaaatcttgagcaatttcacgaacaagacgttggaatggaagtttacggatgagaagctcagtgctcttctgatacttacgg 38822120  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    || || |  |  || || ||||| || | ||| |  || || ||||||||||| ||||| || ||||| |||||||| ||||| || || || |||||||    
38822121 atctctctcaaagcaacagttccaggtctgaatctatgtggcttcttcactcctccggtcgccggagctgatttccgagcggccttggtggcgagctgct 38822220  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccatcgtgagagaa 383  Q
    |||  || || || || ||||||||||||||||||||||||||||||||||||||||||||||||    
38822221 tccggggagccttgccgccggtggatttgcgagctgtttgcttggtacgtgccatcgtgagagaa 38822285  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 106; E-Value: 6e-53
Query Start/End: Original strand, 24 - 373
Target Start/End: Complemental strand, 25865796 - 25865447
Alignment:
24 ctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctggaaac 123  Q
    |||||||||||||| || || |  |||||||||||||| | ||| || |||||||| ||||||||||| ||||| ||   ||||||   |||||| || |    
25865796 ctcttagcatgaattgcacacaaattagtatcctcaaacaatcccacaagataagcctcagcagcttcctgaagtgcaagaacagcatgactctgaaatc 25865697  T
124 ggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggatttc 223  Q
      ||||| ||||||||||| ||||| ||||||||||| ||||| ||||||||||| || ||||| | |||||| || || || || ||||| ||||| ||    
25865696 tcagatccgttttgaaatcctgagcaatttcacgaacaagacgctggaatggaagcttacggatcaaaagctcagtactcttctgatacttacggatctc 25865597  T
224 gcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgcttcctt 323  Q
     ||||| || |||||||| |||||  |||| ||||| ||||||||||||||||||| |||||| |||||||  || ||||| || || || |||||||||    
25865596 acgaagagcaacggttccaggacgataacgatgaggcttcttcactccgccggtggttggagcagatttccttgcagctttggtcgcgagttgcttcctt 25865497  T
324 ggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    ||||| || || ||||||||||||||||| |||||||| ||||| |||||    
25865496 ggtgccttgccgccggtggatttgcgagcagtttgcttcgtacgagccat 25865447  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 83; E-Value: 3e-39
Query Start/End: Original strand, 19 - 373
Target Start/End: Complemental strand, 41944045 - 41943691
Alignment:
19 taactctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctg 118  Q
    |||| |||||||||||||| || || |  || ||||||||||| | |||||| ||||||||||| || ||||| ||||| ||   ||||||    |||||    
41944045 taaccctcttagcatgaattgcacacaaattggtatcctcaaacaatccaaccagataagcttctgctgcttcctgaagtgcaagaacagcatggctctg 41943946  T
119 gaaacggagatctgttttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcgg 218  Q
    ||| | |||||| || |||||||||||||| ||||||||||| ||||||||||||||||| || ||||| | ||| || || || || ||||| || |||    
41943945 gaatctgagatccgtcttgaaatcttgagcaatttcacgaacaagacgttggaatggaagcttacggatcaaaagatcagtactcttctggtatttacgg 41943846  T
219 atttcgcgaagtgcgacggttccgggacggaaacggtgaggtttcttcactccgccggtggctggagcggatttccgggcggcttttgttgctagctgct 318  Q
    || || |||||||| ||||| || |||||  | || ||||||||||| ||||| ||||| |  ||||| ||||| || || || || || || || ||||    
41943845 atctcacgaagtgcaacggtaccaggacgatagcgatgaggtttcttgactccaccggttgtaggagcagatttgcgagcagccttggtggccagttgct 41943746  T
319 tccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    ||||||| || || || ||||||||||||||||| |||||||| ||||| |||||    
41943745 tccttggagccttgccaccggtggatttgcgagcagtttgcttagtacgagccat 41943691  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 24 - 97
Target Start/End: Complemental strand, 44344051 - 44343978
Alignment:
24 ctcttagcatgaatagcgcaaaggttagtatcctcaaagagtccaacgagataagcttcagcagcttcttgaag 97  Q
    ||||||||||||||||| || |  || ||||||||||| | ||| ||||||||||| ||||| ||||| |||||    
44344051 ctcttagcatgaatagcacacaaattggtatcctcaaacaatcccacgagataagcctcagctgcttcctgaag 44343978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 66 - 142
Target Start/End: Complemental strand, 27440951 - 27440875
Alignment:
66 ccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctggaaacggagatctgttttgaaatc 142  Q
    ||||| ||||||||| ||   |||||||||||||| ||||||  ||||||||  || ||||||||||||||||||||    
27440951 ccaacaagataagctacactggcttcttgaagagcagaaacaatgctactctaaaatcggagatctgttttgaaatc 27440875  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 33; Significance: 0.000000002; HSPs: 4)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 66 - 142
Target Start/End: Original strand, 17769236 - 17769312
Alignment:
66 ccaacgagataagcttcagcagcttcttgaagagcggaaacagcgctactctggaaacggagatctgttttgaaatc 142  Q
    ||||| ||||||||| ||   |||||||||||||| |||||||  |||||||  || ||||||||||||||||||||    
17769236 ccaacaagataagctacactggcttcttgaagagcagaaacagtactactctaaaatcggagatctgttttgaaatc 17769312  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 135 - 220
Target Start/End: Original strand, 7594402 - 7594487
Alignment:
135 ttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggatgagaagctctgtgcttttttggtacttgcggat 220  Q
    |||||||||||||| |||||||| || ||||| || |||||||| || ||||| | |||||| || || || |||||||| |||||    
7594402 ttgaaatcttgagcaatttcacggacaagacgctgaaatggaagcttgcggatcaaaagctcagtactcttctggtacttacggat 7594487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 312 - 373
Target Start/End: Original strand, 7594916 - 7594977
Alignment:
312 agctgcttccttggtgcttttcctccggtggatttgcgagctgtttgcttggtacgtgccat 373  Q
    |||||||||||||| || || || ||||| || |||||||| |||||||||||||| |||||    
7594916 agctgcttccttggagccttaccaccggtagacttgcgagcggtttgcttggtacgagccat 7594977  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 135 - 187
Target Start/End: Complemental strand, 18492793 - 18492741
Alignment:
135 ttgaaatcttgagcgatttcacgaacgagacgttggaatggaagttttcggat 187  Q
    |||||||||||||  ||||||||||| ||||  |||||||||||||| |||||    
18492793 ttgaaatcttgagaaatttcacgaacaagacactggaatggaagtttacggat 18492741  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University