View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2077_low_4 (Length: 342)
Name: NF2077_low_4
Description: NF2077
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2077_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 312; Significance: 1e-176; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 312; E-Value: 1e-176
Query Start/End: Original strand, 8 - 327
Target Start/End: Original strand, 36730433 - 36730752
Alignment:
| Q |
8 |
gaacctgtgaataaaatggatggtgatgattttaggtatattccatttggatttggtaggaggggttgtcctggttcatcacttgctttaacggttatac |
107 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36730433 |
gaacatgtgaataaaatggatggtgatgattttaggtatattccatttggatttggtaggaggggttgtcctggttcatcacttgctttaacggttatac |
36730532 |
T |
 |
| Q |
108 |
atttgacaattgctggattgattcaatgttttgaatggaaaattaaaggtggtgataagattgatatggaagaagggtcgtcattttctgctggattggc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36730533 |
atttgacaattgctggattgattcaatgttttgaatggaaaattaaaggtggtgataagattgatatggaagaagggtcgtcattttctgctggattggc |
36730632 |
T |
 |
| Q |
208 |
aaaacctctagtttgttaccctgttacttgttttaatcctttttaagttttatgattattgcatttaccatataagataaatgttgtttaggaaaataaa |
307 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
36730633 |
aaaacctctagtttgttaccctgttacttgttttaatcctttttaagttttatgattattgcatttaccgtataagataaatgttgtttaggaaaataaa |
36730732 |
T |
 |
| Q |
308 |
agtagtactactgttattac |
327 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36730733 |
agtagtactactgttattac |
36730752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University