View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_high_100 (Length: 245)
Name: NF20783_high_100
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_high_100 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 73; Significance: 2e-33; HSPs: 4)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 15 - 87
Target Start/End: Original strand, 14329426 - 14329498
Alignment:
| Q |
15 |
aaatttgagttgttctattctataatcttaggtttatgtgatgatttatgttaagcaaagataagtttacttg |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14329426 |
aaatttgagttgttctattctataatcttaggtttatgtgatgatttatgttaagcaaagataagtttacttg |
14329498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 15 - 87
Target Start/End: Original strand, 14422436 - 14422508
Alignment:
| Q |
15 |
aaatttgagttgttctattctataatcttaggtttatgtgatgatttatgttaagcaaagataagtttacttg |
87 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14422436 |
aaatttgagttgttctattctataatcttaggtttatgtgatgatttatgttaagcaaagataagtttacttg |
14422508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 14329565 - 14329649
Alignment:
| Q |
154 |
gaagataattgtatgcctaatttctactacaatcttaatgaattattcattg-----ttttttgtgttatttatgtggcttcttc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14329565 |
gaagataattgtatgcctaatttctactacaatcttaatgaattattcattgtttttttttttgtgttatttatgtggcttcttc |
14329649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 154 - 233
Target Start/End: Original strand, 14422575 - 14422659
Alignment:
| Q |
154 |
gaagataattgtatgcctaatttctactacaatcttaatgaattattcattg-----ttttttgtgttatttatgtggcttcttc |
233 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14422575 |
gaagataattgtatgcctaatttctactacaatcttaatgaattattcattgtttttttttttgtgttatttatgtggcttcttc |
14422659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University