View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20783_high_123 (Length: 224)

Name: NF20783_high_123
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20783_high_123
NF20783_high_123
[»] chr7 (1 HSPs)
chr7 (1-176)||(40991412-40991587)
[»] chr1 (2 HSPs)
chr1 (136-169)||(16981733-16981766)
chr1 (139-171)||(30354701-30354733)
[»] chr3 (1 HSPs)
chr3 (138-170)||(30639346-30639378)


Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 40991412 - 40991587
Alignment:
1 ataaactaactctctgaggcacatgtatcagagttcgttaagtacttataagcaaatgaacaaatccatgtccatgagacggttaatttgaccttataac 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
40991412 ataaactaactctctgaggcacatgtatcagagttcgttaagtacttataagcaaatgaacaaatccatgtccatgagacggttaatttgaccttataac 40991511  T
101 ttcaaaggtcagaggtcaaaggtcaaatttcatccgagacggttgtaaaatgactattagtgtcactttaatcaat 176  Q
    |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
40991512 ttcaaaggtcagaggtcaaaggtcaaatttcatcagagacggttgtaaaatgactattagtgtcactttaatcaat 40991587  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 169
Target Start/End: Original strand, 16981733 - 16981766
Alignment:
136 gagacggttgtaaaatgactattagtgtcacttt 169  Q
    ||||| ||||||||||||||||||||||||||||    
16981733 gagaccgttgtaaaatgactattagtgtcacttt 16981766  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 171
Target Start/End: Original strand, 30354701 - 30354733
Alignment:
139 acggttgtaaaatgactattagtgtcactttaa 171  Q
    |||||||||||||||| ||||||||||||||||    
30354701 acggttgtaaaatgaccattagtgtcactttaa 30354733  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 170
Target Start/End: Complemental strand, 30639378 - 30639346
Alignment:
138 gacggttgtaaaatgactattagtgtcacttta 170  Q
    ||||||||||||||||||||| |||||||||||    
30639378 gacggttgtaaaatgactatttgtgtcacttta 30639346  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University