View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_high_125 (Length: 221)
Name: NF20783_high_125
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_high_125 |
 | |
|
| [»] chr3 (2 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 213; Significance: 1e-117; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 46599217 - 46598997
Alignment:
| Q |
1 |
cgttgggctaccattgcaaggcttttacctggtagaactgataatgctgtcaagaatcattggaactctacgcttaagcgtagagcgggttgtggtggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46599217 |
cgttgggctaccattgcaaggcttttacctggtagaactgataatgctgtcaagaatcattggaactctacgcttaagcgtagagcgggttgtggtggtt |
46599118 |
T |
|
| Q |
101 |
ctgttacggttgctggaggtggcaacgaaggtggtcagtttacttttccggtggaagatgatccgttgactgcgttgactcttgctcctccggggaatgg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
46599117 |
ctgttacggttgctggaggtggcaacgaaggtggtcagtttacttttccgttggaagatgatccgttgaccgcgttgactcttgctcctccggggaatgg |
46599018 |
T |
|
| Q |
201 |
tgtggaagatagggaggaaat |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46599017 |
tgtggaagatagggaggaaat |
46598997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 63
Target Start/End: Complemental strand, 40752055 - 40752008
Alignment:
| Q |
16 |
gcaaggcttttacctggtagaactgataatgctgtcaagaatcattgg |
63 |
Q |
| |
|
||||| ||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
40752055 |
gcaagacttttccctggtagaactgataatgctgtgaagaatcattgg |
40752008 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 13 - 59
Target Start/End: Complemental strand, 31791067 - 31791021
Alignment:
| Q |
13 |
attgcaaggcttttacctggtagaactgataatgctgtcaagaatca |
59 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||||| |||||||| |
|
|
| T |
31791067 |
attgctaggcttttccctggaagaactgataatgctgttaagaatca |
31791021 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University