View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_high_13 (Length: 516)
Name: NF20783_high_13
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_high_13 |
 |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0136 (3 HSPs) |
 |  |  |
|
| [»] scaffold0176 (1 HSPs) |
 |  |  |
|
| [»] scaffold0725 (2 HSPs) |
 |  |  |
|
| [»] scaffold0040 (2 HSPs) |
 |  |  |
|
| [»] scaffold0804 (1 HSPs) |
 |  |  |
|
| [»] scaffold0210 (2 HSPs) |
 |  |  |
|
| [»] scaffold0014 (3 HSPs) |
 |  |  |
|
| [»] scaffold0228 (3 HSPs) |
 |  |  |
|
| [»] scaffold0933 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0769 (1 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |  |
|
| [»] scaffold0384 (1 HSPs) |
 |  |  |
|
| [»] scaffold0177 (1 HSPs) |
 |  |  |
|
| [»] scaffold0031 (1 HSPs) |
 |  |  |
|
| [»] scaffold0142 (1 HSPs) |
 |  |  |
|
| [»] scaffold0032 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 123; Significance: 6e-63; HSPs: 65)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 123; E-Value: 6e-63
Query Start/End: Original strand, 329 - 505
Target Start/End: Complemental strand, 27242813 - 27242634
Alignment:
| Q |
329 |
atccaggggcagatctctattgagaccccaaggtgctgtggcaccccccaatnnnnnnnnn---tttgtatactgaaaattactatagtacccttgaatt |
425 |
Q |
| |
|
|||||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27242813 |
atccaggggcggatctctattgagacccccaggtgctgtggcaccccccaataaaaaaaaaaaatttgtatactgaaaattactatagtacccttgaatt |
27242714 |
T |
 |
| Q |
426 |
cctctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
505 |
Q |
| |
|
|| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27242713 |
cccctgattatttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
27242634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 43635835 - 43635888
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
43635835 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgccccct |
43635888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 14625370 - 14625425
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
14625370 |
gggttaataggtctttaccccctgtaatataggacacttttggttttgccccctgt |
14625425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 1825291 - 1825349
Alignment:
| Q |
139 |
tatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
1825291 |
tatgagttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
1825349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 26097090 - 26097029
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| |||||||||||||||| ||||| |
|
|
| T |
26097090 |
atttaagggttaataggtctttaccccctgtaatataggtcacttttggttttgcctcctgt |
26097029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 8928815 - 8928870
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||||| ||||||||||||| |
|
|
| T |
8928815 |
gggttaataggtctttaccccctgtaatataaggcacttttgattttgccccctgt |
8928870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 26095814 - 26095869
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||| |||||||||||||||| |
|
|
| T |
26095814 |
gggttaataggtctttaccccctgtaatataggtcacttatggttttgccccctgt |
26095869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 13902066 - 13902120
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||| ||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
13902066 |
ggttaataggtctttaccacctgtaatatagggcagttttggttttgccccctgt |
13902120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 14626836 - 14626780
Alignment:
| Q |
142 |
gggttaataggtctttac-cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
14626836 |
gggttaataggtctttactcccctgtaatatagggcacttttggttttgcctcctgt |
14626780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 23322667 - 23322611
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||||||||||||||||||||||| |
|
|
| T |
23322667 |
gggttaataggtctttacccccctgtaatatagagcacttttggttttgccccctgt |
23322611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 51470128 - 51470184
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | ||||||||||||||||| |||| |
|
|
| T |
51470128 |
tgggttaataggtctttaccccctgtaatataagtcacttttggttttgccctctgt |
51470184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 16785722 - 16785777
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
16785722 |
gggttaataggcctttaccccctgtaatgtaggtcacttttggttttgccccctgt |
16785777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 137 - 196
Target Start/End: Original strand, 24545452 - 24545511
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctg |
196 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
24545452 |
tttaagggttaataggcttttaccccctataatataggtcacttttggttttgcctcctg |
24545511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 32131960 - 32131909
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||| ||||||||||| |
|
|
| T |
32131960 |
gggttaataggtctttaccccctgtaatataggtcactttcggttttgcccc |
32131909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 52084893 - 52084827
Alignment:
| Q |
133 |
aaaatttatgggttaataggtctttaccccc--tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||| |||||||||||||||||||||||| | |||||||| ||||||||||||||| ||||||| |
|
|
| T |
52084893 |
aaaattcatgggttaataggtctttaccccccctgtaatatagagcacttttggttttgtcccctgt |
52084827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 142 - 191
Target Start/End: Complemental strand, 13903428 - 13903379
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcc |
191 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
13903428 |
gggttaatagatctttaccccctgtaatataggtcacttttggttttgcc |
13903379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 40247435 - 40247382
Alignment:
| Q |
145 |
ttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
40247435 |
ttaataggtctttacccccatgtaatatagggcacttttggttttcccccctgt |
40247382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 9441567 - 9441623
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| | |||||||||||||||||||||| |
|
|
| T |
9441567 |
gggttaataggtctttacccccctgtaatataagacacttttggttttgccccctgt |
9441623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 9443047 - 9442995
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||||||||||||||||||| |
|
|
| T |
9443047 |
gggttaataggtctttacccccctgtaatatagagcacttttggttttgcccc |
9442995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 137 - 193
Target Start/End: Complemental strand, 14978771 - 14978715
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||| ||||||||||| ||||||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
14978771 |
tttaagggttaataggcctttaccccctgttatataggacacttttggttttgcccc |
14978715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 33667690 - 33667634
Alignment:
| Q |
142 |
gggttaataggtctttac-cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
33667690 |
gggttaataggcctttacacccctgtaatataggtcacttttggttttgccccctgt |
33667634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 141 - 192
Target Start/End: Original strand, 52083579 - 52083631
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc-tataatatagggcacttttggttttgccc |
192 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
52083579 |
tgggttaataggtctttacccccctgtaatatagggcatttttggttttgccc |
52083631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 144 - 187
Target Start/End: Original strand, 2273503 - 2273546
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggttt |
187 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
2273503 |
gttaataggtctttaccccctgtaatatagggcactttttgttt |
2273546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 14978311 - 14978361
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||| | ||||||||||||||||||||||||| |||| |
|
|
| T |
14978311 |
gggttaataggtctttacctc-tataatatagggcacttttggtttttcccc |
14978361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 143 - 197
Target Start/End: Complemental strand, 47146425 - 47146370
Alignment:
| Q |
143 |
ggttaataggtctttacccccta-taatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
47146425 |
ggttaataggtctttacccccttgtaatataggtcacttttggttttgctccctgt |
47146370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 135 - 193
Target Start/End: Original strand, 15336368 - 15336426
Alignment:
| Q |
135 |
aatttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||| ||| |||||||||||||||||||| ||||||||| || |||||||||| |||| |
|
|
| T |
15336368 |
aatttttggattaataggtctttaccccctgtaatataggtcatttttggtttttcccc |
15336426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 141 - 195
Target Start/End: Complemental strand, 25601976 - 25601922
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
25601976 |
tgggttaataggcctttaccccctgcaatataggtcacttttggttttcccccct |
25601922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 134 - 197
Target Start/End: Complemental strand, 27549023 - 27548958
Alignment:
| Q |
134 |
aaatttatgggttaataggtctttaccccctata--atatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| |||||||||| ||||||||||| || |||||| ||||||||||||||||| ||||| |
|
|
| T |
27549023 |
aaatttattggttaataggcctttaccccctgtaatatatagtgcacttttggttttgccgcctgt |
27548958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 141 - 193
Target Start/End: Complemental strand, 2274721 - 2274668
Alignment:
| Q |
141 |
tgggttaataggtctttac-cccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| ||||||| |||||||||||||||| ||||||||||||||||| |
|
|
| T |
2274721 |
tgggttaataagtctttattcccctataatatagggtacttttggttttgcccc |
2274668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 133 - 197
Target Start/End: Original strand, 25600922 - 25600986
Alignment:
| Q |
133 |
aaaatttatgggttaataggtctttacccc-ctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||| || |||||||| ||||||||||||| |||||||| |
|
|
| T |
25600922 |
aaaattta-gggttaataggtctttacccctctgcaatataggtcacttttggttttcccccctgt |
25600986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 4646752 - 4646812
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||| | || |||||||||| ||| |||| |
|
|
| T |
4646752 |
tttaagggttaataggtctttaccccctctaatataagtcatttttggttttcccctctgt |
4646812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 7112493 - 7112549
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | || ||| |||||| |||||||| |
|
|
| T |
7112493 |
tgggttaataggtctttaccccctgtaatatatgtcattttcggtttttccccctgt |
7112549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 23321263 - 23321315
Alignment:
| Q |
142 |
gggttaataggtctttaccc-cctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| |||||| || ||| |||||||||||||||||||||||||||| |
|
|
| T |
23321263 |
gggttaatagatctttatcctcctgtaatatagggcacttttggttttgcccc |
23321315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 187
Target Start/End: Original strand, 27523799 - 27523843
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttt |
187 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
27523799 |
ggttaataggactttaccctgtataatatagggcacttttggttt |
27523843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 32130644 - 32130700
Alignment:
| Q |
142 |
gggttaataggtctttacccccta-taatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| ||||||||||||| || ||||| |
|
|
| T |
32130644 |
gggttaataggcctttaccccctagtaatataggtcacttttggttttaccacctgt |
32130700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 193
Target Start/End: Original strand, 33645013 - 33645065
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
33645013 |
tgggttattagatctttaccccctgtaatataggtcacttttgattttgcccc |
33645065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 44312188 - 44312132
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||| ||||| ||||||||||| |||||||||||| || ||||||||||||||| |
|
|
| T |
44312188 |
tgggtttataggcctttaccccctgaaatatagggcacattcggttttgccccctgt |
44312132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 49201443 - 49201387
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
49201443 |
tgggttaataggcttttaccccctgcaatataggtcacttttggttttcccccctgt |
49201387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 10028034 - 10027979
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || || ||||||| ||| |||| |
|
|
| T |
10028034 |
gggttaataggtctttaccccctgtaatataggtcatttctggttttcccctctgt |
10027979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 35979641 - 35979590
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||| |||||| ||||||| | |||||||| ||||||||| |
|
|
| T |
35979641 |
gggttaataggtcttttccccctgtaatataagtcacttttgattttgcccc |
35979590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 38742438 - 38742387
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| ||||||| ||||||||| |
|
|
| T |
38742438 |
gggttaatagagctttaccccctgtaatatagggtacttttgattttgcccc |
38742387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 44200327 - 44200382
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| || |||||||||| | |||||| |
|
|
| T |
44200327 |
gggttaataggtctttaccccttgtaatataggccatttttggttttccaccctgt |
44200382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 22591280 - 22591326
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||| ||||||||| | ||||||||| ||||||||||||| |
|
|
| T |
22591280 |
gggttaataggcctttaccccttgtaatataggtcacttttggtttt |
22591326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 134 - 164
Target Start/End: Original strand, 28797151 - 28797181
Alignment:
| Q |
134 |
aaatttatgggttaataggtctttaccccct |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
28797151 |
aaatttatgggttaataggtctttaccccct |
28797181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 155 - 197
Target Start/End: Original strand, 35978727 - 35978769
Alignment:
| Q |
155 |
tttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||| | ||||||||||||||||| |||| |
|
|
| T |
35978727 |
tttaccccctataatatatgtcacttttggttttgccctctgt |
35978769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 44311208 - 44311254
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| |||||||| |||| |
|
|
| T |
44311208 |
gggttaataggcctttaccccctgtaatataggacacttttgctttt |
44311254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 47221995 - 47221949
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||| ||| |||||||| ||||||||||||| |
|
|
| T |
47221995 |
gggttaataggtctttacctcctgcaatataggtcacttttggtttt |
47221949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 155 - 192
Target Start/End: Complemental strand, 4488755 - 4488718
Alignment:
| Q |
155 |
tttaccccctataatatagggcacttttggttttgccc |
192 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
4488755 |
tttaccccctataatatagaacacttttggttttgccc |
4488718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 5560876 - 5560925
Alignment:
| Q |
145 |
ttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||| | |||||||| |||||||||||||| |||| |
|
|
| T |
5560876 |
ttaataggtctttacccccctgtaatatagagcacttttggttttccccc |
5560925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 142 - 171
Target Start/End: Complemental strand, 13154796 - 13154767
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatat |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
13154796 |
gggttaataggtctttaccccctataatat |
13154767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 174
Target Start/End: Complemental strand, 18458864 - 18458827
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
18458864 |
tttaagggttaataggtctttaccccctgtaatatagg |
18458827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 189
Target Start/End: Original strand, 20132380 - 20132429
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc-tataatatagggcacttttggttttg |
189 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||| |||||||||||||| |
|
|
| T |
20132380 |
tgggttaataggcctttacccccctgtaatataggtcacttttggttttg |
20132429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 31648074 - 31648131
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||| |||||||||| | ||||||||| ||||||||||||| ||||||| |
|
|
| T |
31648074 |
tgggttaataggcctttacccccatgtaatataggtcacttttggttttatcccctgt |
31648131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 1826492 - 1826436
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||| || ||||||||| | ||||||||| |||||||| ||||||||||||| |
|
|
| T |
1826492 |
gggttaatatgtttttacccccctgtaatataggtcacttttgattttgccccctgt |
1826436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 9439459 - 9439427
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
9439459 |
gggttaataggtctttaccccctgtaatatagg |
9439427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 144 - 188
Target Start/End: Original strand, 21853418 - 21853462
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || || ||||||| |
|
|
| T |
21853418 |
gttaataggtctttaccccctgtaatataggtcatttctggtttt |
21853462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 24987608 - 24987640
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
24987608 |
gggttaataggtctttaccccctgtaatatagg |
24987640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 25235774 - 25235806
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
25235774 |
gggttaataggtctttaccccctgtaatatagg |
25235806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 31532552 - 31532492
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| ||||||||||||||||| | ||||||||||||| || || ||||||| ||| |||| |
|
|
| T |
31532552 |
tttaagggttaataggtctttatctcctataatataggtcatttctggtttttccctctgt |
31532492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 33934637 - 33934693
Alignment:
| Q |
142 |
gggttaataggtctttac-cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
33934637 |
gggttaatagggttttacgcccctgtaatatagatcacttttggttttgccccctgt |
33934693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 36343154 - 36343210
Alignment:
| Q |
142 |
gggttaataggtctttaccc-cctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| || |||| ||||| |||||||| |
|
|
| T |
36343154 |
gggttaataggtctttaccctcctgtaatataggtcattttttgttttcccccctgt |
36343210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 136 - 188
Target Start/End: Complemental strand, 39160595 - 39160543
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||||| | ||||||||||| ||||||||| || |||||||||| |
|
|
| T |
39160595 |
atttatgggttaatggtgctttaccccctgtaatataggtcatttttggtttt |
39160543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 44754660 - 44754604
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||| | |||||||| ||||||||||||| |||||||| |
|
|
| T |
44754660 |
gggttaataggcctttacccccctgcaatataggtcacttttggttttcccccctgt |
44754604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 141 - 193
Target Start/End: Original strand, 46136085 - 46136137
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||| || |||| ||||| |||| |
|
|
| T |
46136085 |
tgggttaataagtctttaccccctgtaatataggtcattttttgttttccccc |
46136137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 47022126 - 47022094
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
47022126 |
gggttaataggtctttaccccctgtaatatagg |
47022094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 116; Significance: 9e-59; HSPs: 44)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 332 - 505
Target Start/End: Complemental strand, 9356785 - 9356605
Alignment:
| Q |
332 |
caggggcagatctctattgagaccccaaggtgctgtggcaccccccaatnnnnnnnnn-------tttgtatactgaaaattactatagtacccttgaat |
424 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
9356785 |
caggggcggatctctattgagacccccaggtgctgtggcaccccccaataaaaataaaaataaaatttgtatactgaaaattactatagtacccttgaat |
9356686 |
T |
 |
| Q |
425 |
tcctctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
505 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9356685 |
tcccctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
9356605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 9553395 - 9553455
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
9553395 |
tttaagggttaataggtctttaccccctgtaatatagggcacttttggttttgcctcctgt |
9553455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 48168850 - 48168905
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
48168850 |
gggttaataggtctttaccctctgtaatatagggcacttttggttttgccccctgt |
48168905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 136 - 195
Target Start/End: Complemental strand, 21237408 - 21237349
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
21237408 |
atttaagggttaataggcatttaccccctataatataggtcacttttggttttgccccct |
21237349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 142 - 196
Target Start/End: Original strand, 34158058 - 34158113
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctg |
196 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
34158058 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctg |
34158113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 142 - 196
Target Start/End: Complemental strand, 1594181 - 1594127
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctg |
196 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||| |||| |
|
|
| T |
1594181 |
gggttaataggtctttaccccctgtaatataggtcacttttggttttgcctcctg |
1594127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 17764758 - 17764701
Alignment:
| Q |
141 |
tgggttaataggtctttacccc-ctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||| || || |||||||||||||||||||||||||||||||| |
|
|
| T |
17764758 |
tgggttaataggtctttactccactgtaatatagggcacttttggttttgccccctgt |
17764701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 446 - 491
Target Start/End: Original strand, 46071210 - 46071255
Alignment:
| Q |
446 |
ctctctctcggtaccccctctcctctccatcctcacatatcaaaac |
491 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
46071210 |
ctctctctcggtaccccctctcctctccctcctcacatatcaaaac |
46071255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 17763336 - 17763392
Alignment:
| Q |
142 |
gggttaataggtctttacccc-ctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| || ||||||||| |||||||||||||||||||||| |
|
|
| T |
17763336 |
gggttaataggtctttacccctctgtaatataggacacttttggttttgccccctgt |
17763392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 136 - 190
Target Start/End: Original strand, 8174878 - 8174932
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgc |
190 |
Q |
| |
|
|||| |||| ||||||||||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
8174878 |
atttttgggctaataggtctttaccccctgtaatatagggcatttttggttttgc |
8174932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 9554317 - 9554261
Alignment:
| Q |
142 |
gggttaataggtctttaccc-cctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||| ||||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
9554317 |
gggttaataaatctttaccctcctgtaatatagggcacttttggttttgccccctgt |
9554261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 11056729 - 11056781
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||||||||||||| |
|
|
| T |
11056729 |
gggttaataggtctttacccccctgtaatataaggcacttttggttttgcccc |
11056781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 13279475 - 13279419
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||| |||||| |||||||| |
|
|
| T |
13279475 |
tgggttaataggtctttaccccctgtaatataggtcattttcggtttttccccctgt |
13279419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 1832036 - 1831985
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||| ||||||||||| |||||||||||||||||| |||| |||| |
|
|
| T |
1832036 |
gggttaatagggctttaccccctgtaatatagggcacttttgattttccccc |
1831985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 138 - 193
Target Start/End: Original strand, 23371445 - 23371500
Alignment:
| Q |
138 |
ttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| || || ||||||| |||| |
|
|
| T |
23371445 |
ttatgggttaataggtctttaccccctgtaatataggtcatttatggttttccccc |
23371500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 132 - 195
Target Start/End: Original strand, 33757400 - 33757463
Alignment:
| Q |
132 |
aaaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||| | |||||||||| |||||||||||| ||||||||| |||||||| |||| |||||| |
|
|
| T |
33757400 |
aaaaattaaagggttaatagatctttaccccctgtaatataggtcacttttgattttcccccct |
33757463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 42509095 - 42509040
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
42509095 |
gggttaatagtgttttaccctctgtaatatagggcacttttggttttgccccctgt |
42509040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 144 - 197
Target Start/End: Original strand, 1589387 - 1589441
Alignment:
| Q |
144 |
gttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||| |||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
1589387 |
gttaataggcctttacccccctgtaatataggtcacttttggttttgccccctgt |
1589441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 19272506 - 19272460
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || |||||||||| |
|
|
| T |
19272506 |
gggttaataggtctttaccccctgtaatataggtcatttttggtttt |
19272460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 144 - 190
Target Start/End: Original strand, 48896481 - 48896527
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggttttgc |
190 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
48896481 |
gttaataggtctttacctcctgtaatataggtcacttttggttttgc |
48896527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 5766632 - 5766693
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| || || |||||| |||||||| |
|
|
| T |
5766632 |
atttatgggttaatatgtctttaccccctgtaatataggtcatttccggtttttccccctgt |
5766693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 48848203 - 48848142
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||||||| || |||| ||||| |||||||| |
|
|
| T |
48848203 |
atttatgggttaatggtgctttaccccctataatataggtcattttttgttttcccccctgt |
48848142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 5219094 - 5219038
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| |||||||| ||||||||||||| |
|
|
| T |
5219094 |
gggttaataggcctttacccccctgtaatataggtcacttttgattttgccccctgt |
5219038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 5909712 - 5909768
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| || || ||||||| |||||||| |
|
|
| T |
5909712 |
tgggttaataggtctttaccccatgtaatataggtcatttctggtttttccccctgt |
5909768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 134 - 174
Target Start/End: Original strand, 23784576 - 23784616
Alignment:
| Q |
134 |
aaatttatgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
23784576 |
aaatttaagggttaataggtctttaccccctgtaatatagg |
23784616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 23806949 - 23806901
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||| |||||||||| |||||||||| ||||||||||||| |
|
|
| T |
23806949 |
atgggttaatagacctttacccccgataatataggtcacttttggtttt |
23806901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 24434907 - 24434963
Alignment:
| Q |
142 |
gggttaataggtcttta-ccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| |||||| |||||| |||||||||| ||||||||| |||| |
|
|
| T |
24434907 |
gggttaataggtctttacccccctgtaatatcgggcacttttcgttttgccctctgt |
24434963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 38193252 - 38193196
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || || ||||||| ||||||| |
|
|
| T |
38193252 |
tgggttaataggtctttaccccctgtaatataggtcatttctggttttctcccctgt |
38193196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 14554505 - 14554450
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| || |||| ||||| |||||||| |
|
|
| T |
14554505 |
gggttaataggcctttaccccctgtaatataggtcattttttgttttcccccctgt |
14554450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 140 - 183
Target Start/End: Original strand, 42202159 - 42202202
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagggcacttttg |
183 |
Q |
| |
|
||||||||||||||||||||||||| |||||||| |||||||| |
|
|
| T |
42202159 |
atgggttaataggtctttaccccctgcaatataggtcacttttg |
42202202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 48945184 - 48945235
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||| ||||||| || ||||||||| || ||||||||||||||| |
|
|
| T |
48945184 |
gggttaataggtttttaccctctgtaatataggtcatttttggttttgcccc |
48945235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 138 - 172
Target Start/End: Complemental strand, 3951663 - 3951629
Alignment:
| Q |
138 |
ttatgggttaataggtctttaccccctataatata |
172 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3951663 |
ttatgggttaataggtctttacctcctataatata |
3951629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 172
Target Start/End: Complemental strand, 19979935 - 19979905
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatata |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
19979935 |
gggttaataggtctttaccccctataatata |
19979905 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 195
Target Start/End: Complemental strand, 24758049 - 24757995
Alignment:
| Q |
142 |
gggttaataggtctttac-cccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||| |||| ||||||||||||||| |
|
|
| T |
24758049 |
gggttaataggtctttacccccctgtaatatagatcactattggttttgccccct |
24757995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 26050175 - 26050221
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||| |||||| |
|
|
| T |
26050175 |
gggttaataggtctttaccccctctaatataggtcattttcggtttt |
26050221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 26059534 - 26059580
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||| |||||| |
|
|
| T |
26059534 |
gggttaataggtctttaccccctctaatataggtcattttcggtttt |
26059580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 174
Target Start/End: Original strand, 9915646 - 9915683
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
9915646 |
tttaagggttaataggtctttaccccctgtaatatagg |
9915683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 174
Target Start/End: Original strand, 9923558 - 9923595
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
9923558 |
tttaagggttaataggtctttaccccctgtaatatagg |
9923595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 39580224 - 39580191
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
39580224 |
tgggttaataggtctttaccccctgtaatatagg |
39580191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 48170316 - 48170264
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||| ||||||||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
48170316 |
gggttaagaggtctttacctcctgtaatata---cacttttggttttgccccctgt |
48170264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 6269528 - 6269560
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
6269528 |
gggttaataggtctttaccccctgtaatatagg |
6269560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 13286923 - 13286867
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| || || ||||||| |||||||| |
|
|
| T |
13286923 |
gggttaataggtctttacccccttgtaatataggtcatttctggttttcccccctgt |
13286867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 23161100 - 23161152
Alignment:
| Q |
142 |
gggttaataggtctttaccc-cctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| |||||||||||| |||| |
|
|
| T |
23161100 |
gggttaataggtctttaccctcctgtaatataggttacttttggtttttcccc |
23161152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 45865709 - 45865653
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| || ||||||| | ||||||||| ||||||||||||| |||||||| |
|
|
| T |
45865709 |
gggttaataggcctctacccccctgtaatataggtcacttttggttttaccccctgt |
45865653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 116; Significance: 9e-59; HSPs: 57)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 9e-59
Query Start/End: Original strand, 332 - 505
Target Start/End: Complemental strand, 44052868 - 44052688
Alignment:
| Q |
332 |
caggggcagatctctattgagaccccaaggtgctgtggcaccccccaatnnnnnnnnn-------tttgtatactgaaaattactatagtacccttgaat |
424 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
44052868 |
caggggcggatctctattgagacccccaggtgctgtggcaccccccaataaaaaaaaaaaaaaaatttgtatactgaaaattactatagtacccttgaat |
44052769 |
T |
 |
| Q |
425 |
tcctctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
505 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44052768 |
tcccctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
44052688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 113; E-Value: 5e-57
Query Start/End: Original strand, 327 - 505
Target Start/End: Original strand, 44351989 - 44352174
Alignment:
| Q |
327 |
gtatccaggggcagatctctattgagaccccaaggtgctgtggcacccccc-------aatnnnnnnnnntttgtatactgaaaattactatagtaccct |
419 |
Q |
| |
|
|||||||||||| |||||||||||||||||| ||||||||||||||||||| || ||||||||||||||||||| |||||||||| |
|
|
| T |
44351989 |
gtatccaggggcggatctctattgagacccccaggtgctgtggcacccccccaataaaaaaaaaaaaaaatttgtatactgaaaattaccatagtaccct |
44352088 |
T |
 |
| Q |
420 |
tgaattcctctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
505 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44352089 |
tgaattcccctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
44352174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 390 - 505
Target Start/End: Complemental strand, 54537002 - 54536887
Alignment:
| Q |
390 |
tttgtatactgaaaattactatagtacccttgaattcctctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaa |
489 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54537002 |
tttgtatactgaaaattactatagtacccttgaatttccctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaa |
54536903 |
T |
 |
| Q |
490 |
acaccattcttctcac |
505 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
54536902 |
acaccattcttctcac |
54536887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 54; E-Value: 9e-22
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 46610007 - 46610064
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
46610007 |
atgggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
46610064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 10615276 - 10615330
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10615276 |
ggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
10615330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 432 - 505
Target Start/End: Original strand, 18321970 - 18322044
Alignment:
| Q |
432 |
attgtttttgtctgc-tctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
505 |
Q |
| |
|
||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
18321970 |
attgtttttgtctgcctctctcgcggtaccccctctcctctccatcctcacatatcaaaacgtgattcttctcac |
18322044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 37977563 - 37977508
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
37977563 |
gggttaataggtctttaccccctgtaatataggacacttttggttttgccccctgt |
37977508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 46597565 - 46597510
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
46597565 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgcctcctgt |
46597510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 18142261 - 18142199
Alignment:
| Q |
135 |
aatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
18142261 |
aatttaagggttaataggcctttaccccctgtaatataggtcacttttggttttgccccctgt |
18142199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 141 - 195
Target Start/End: Complemental strand, 54567801 - 54567747
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
54567801 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccct |
54567747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 144 - 197
Target Start/End: Original strand, 48044276 - 48044329
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
48044276 |
gttaataggtctttaccccctgtgatatagggcacttttggttttgccccctgt |
48044329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 10616831 - 10616775
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
10616831 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
10616775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 15086222 - 15086278
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
15086222 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
15086278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 15093771 - 15093716
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||| ||||||||||||| |
|
|
| T |
15093771 |
gggttaatagaactttaccccctataatatagggtacttttgattttgccccctgt |
15093716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 18140940 - 18140995
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
18140940 |
gggttaataggcctttaccccctgtaatataggtcacttttggttttgctccctgt |
18140995 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 141 - 191
Target Start/End: Original strand, 29183731 - 29183781
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgcc |
191 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |||||||| ||||||| |
|
|
| T |
29183731 |
tgggttaataggtctttatcccctataatataggtcacttttgattttgcc |
29183781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 28206982 - 28207038
Alignment:
| Q |
142 |
gggttaataggtctttaccc-cctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
28206982 |
gggttaatagggctttaccctcctgtaatatagggcacttttggttttcccccctgt |
28207038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 29185039 - 29184983
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||| |||||||||||||||| ||||| |
|
|
| T |
29185039 |
tgggttaataggcctttactccctgtaatataggtcacttttggttttgcctcctgt |
29184983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 143 - 197
Target Start/End: Complemental strand, 4218923 - 4218868
Alignment:
| Q |
143 |
ggttaataggtctttacccccta-taatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
4218923 |
ggttaataggcctttaccccctggtaatataggtcacttttggttttgccccctgt |
4218868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 7248865 - 7248920
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| || ||||||||||||||||||| |
|
|
| T |
7248865 |
gggttaataggcctttaccccctgtaatatagatcatttttggttttgccccctgt |
7248920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 138 - 193
Target Start/End: Original strand, 12210024 - 12210079
Alignment:
| Q |
138 |
ttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||| |||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
12210024 |
ttatgggttaatagacttttaccccctgtaatataggtcacttttggttttgcccc |
12210079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 31835898 - 31835843
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| | |||||||| ||||||||||||| |
|
|
| T |
31835898 |
gggttaatatgtctttaccccctgtaatatatgacacttttgattttgccccctgt |
31835843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 49263029 - 49263075
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
49263029 |
gggttaataggtctttaccccctataatatagatcacttttgatttt |
49263075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 141 - 193
Target Start/End: Complemental strand, 22257391 - 22257338
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||| | || |||||||||||||| |||||||||| |
|
|
| T |
22257391 |
tgggttaataggtctttacccccctgtattatagggcactttttgttttgcccc |
22257338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 132 - 193
Target Start/End: Original strand, 45291410 - 45291471
Alignment:
| Q |
132 |
aaaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||| ||| ||||||||| | | ||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
45291410 |
aaaaaattaagggttaatatgcccttaccccctgtaatataggtcacttttggttttgcccc |
45291471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 18704953 - 18705009
Alignment:
| Q |
142 |
gggttaataggtctttacccccta-taatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
18704953 |
gggttaatagagctttaccccccagtaatatagggcacttttggttttcccccctgt |
18705009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 19756861 - 19756917
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||| | ||||||||||||||||||||| || |||||||||| |||||||| |
|
|
| T |
19756861 |
tgggttaatggtgctttaccccctataatataggtcatttttggttttcccccctgt |
19756917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 22256202 - 22256258
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||| |||||||||||| | ||||||| | |||||||||||||||||||||| |
|
|
| T |
22256202 |
gggttaataagtctttacccccctgtaatatatgacacttttggttttgccccctgt |
22256258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 38843607 - 38843551
Alignment:
| Q |
142 |
gggttaataggtctttacccccta-taatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| ||||||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
38843607 |
gggttgataggtctttacccctttgtaatataggacacttttggttttgccccctgt |
38843551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 11359457 - 11359508
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
11359457 |
gggttaataggcctttaccccctgcaatataggtcacttttggttttccccc |
11359508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 144 - 191
Target Start/End: Complemental strand, 24910986 - 24910939
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggttttgcc |
191 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
24910986 |
gttaatagatctttaccccctgtaatatagatcacttttggttttgcc |
24910939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 40462800 - 40462745
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| || |||| ||||| || ||||| |
|
|
| T |
40462800 |
gggttaataggtctttaccccatataatataggtcattttttgtttttcctcctgt |
40462745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 189
Target Start/End: Original strand, 46596095 - 46596142
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttg |
189 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
46596095 |
gggttaatagagctttaccccctgtaatatagggtacttttggttttg |
46596142 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 188
Target Start/End: Complemental strand, 47115620 - 47115573
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||| |||||| |
|
|
| T |
47115620 |
tgggttaataggtctttaccccctgtaatataggtcattttcggtttt |
47115573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 332 - 380
Target Start/End: Complemental strand, 54537068 - 54537018
Alignment:
| Q |
332 |
caggggcagatctctattgagaccccaa--ggtgctgtggcaccccccaat |
380 |
Q |
| |
|
||||||| |||||||||||||||||| | ||||||||||||||||||||| |
|
|
| T |
54537068 |
caggggcggatctctattgagacccccaggggtgctgtggcaccccccaat |
54537018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 128 - 193
Target Start/End: Complemental strand, 8355638 - 8355572
Alignment:
| Q |
128 |
aatgaaaaatttatgggttaataggtctttac-cccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||| |||||| ||||||||||||||||||| ||||| ||||||||| || || ||||||| |||| |
|
|
| T |
8355638 |
aatgataaatttttgggttaataggtctttacccccctgtaatataggtcatttctggttttccccc |
8355572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 11360411 - 11360349
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| |||||||||||| |||||||||| | |||||||| ||||||||||||| |||||||| |
|
|
| T |
11360411 |
atttttgggttaataggcctttacccccctgcaatataggtcacttttggttttcccccctgt |
11360349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 145 - 195
Target Start/End: Complemental strand, 31173638 - 31173589
Alignment:
| Q |
145 |
ttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||||||||||| | |||||||| |||||||||||||||||||| |
|
|
| T |
31173638 |
ttaataggtctttacccc-tgtaatatagatcacttttggttttgccccct |
31173589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 51460820 - 51460774
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || |||| ||||| |
|
|
| T |
51460820 |
gggttaataggtctttaccccctgtaatataggtcattttttgtttt |
51460774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 14824749 - 14824806
Alignment:
| Q |
141 |
tgggttaataggtctttac-cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
14824749 |
tgggttaatagtgctttacgcccctgtaatataggtcacttttgattttgccccctgt |
14824806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 43112020 - 43112081
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| ||||||||||| ||||||| ||| ||||||| ||||||||||||| |||||||| |
|
|
| T |
43112020 |
atttaagggttaataggcctttacctcctgtaatataaatcacttttggttttaccccctgt |
43112081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 49880795 - 49880762
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
49880795 |
tgggttaataggtctttaccccctgtaatatagg |
49880762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 143 - 188
Target Start/End: Complemental strand, 52396499 - 52396454
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||||| ||||||| |
|
|
| T |
52396499 |
ggttaatagggctttaccccctgtaatatagagcacttctggtttt |
52396454 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 54566506 - 54566566
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| |||||||||| ||||||||| | ||||||||| |||||||||||||| ||||||| |
|
|
| T |
54566506 |
atttaagggttaatagacctttacccc-tgtaatataggtcacttttggttttgtcccctgt |
54566566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 4217679 - 4217731
Alignment:
| Q |
145 |
ttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| ||||||||||| ||||||||| ||||||| |||||||| |||| |
|
|
| T |
4217679 |
ttaataggcctttaccccctgtaatataggtaacttttgattttgccctctgt |
4217731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 6510215 - 6510247
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
6510215 |
gggttaataggtctttaccccctgtaatatagg |
6510247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 20737510 - 20737542
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
20737510 |
gggttaataggtttttaccccctataatatagg |
20737542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 24729688 - 24729632
Alignment:
| Q |
142 |
gggttaataggtctttac-cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||||| ||||||||||||||| ||||| |
|
|
| T |
24729688 |
gggttaataggcctttactcccctgtaatataggttacttttggttttgcctcctgt |
24729632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 28208202 - 28208150
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
28208202 |
gggttaatagagctttacccccctgtaatatagggcacttttggttttccccc |
28208150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 141 - 189
Target Start/End: Original strand, 31172298 - 31172346
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttg |
189 |
Q |
| |
|
|||||||||||| ||||||| ||| ||||||||| || ||||||||||| |
|
|
| T |
31172298 |
tgggttaataggcctttaccacctgtaatataggtcatttttggttttg |
31172346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 34062403 - 34062340
Alignment:
| Q |
133 |
aaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| |||||||| | ||||| ||||| ||||||||| ||||||||||||| |||||||| |
|
|
| T |
34062403 |
aaaattta-gggttaattgacctttatcccctgtaatataggtcacttttggtttttccccctgt |
34062340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 36867914 - 36867882
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
36867914 |
gggttaatagatctttaccccctataatatagg |
36867882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 159 - 195
Target Start/End: Original strand, 37975987 - 37976023
Alignment:
| Q |
159 |
ccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
37975987 |
ccccctgtaatatagggtacttttggttttgccccct |
37976023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 194
Target Start/End: Original strand, 38343184 - 38343236
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccc |
194 |
Q |
| |
|
||||||||||| ||||||| ||| ||||||| | |||||||| |||||||||| |
|
|
| T |
38343184 |
gggttaataggcctttacctcctgtaatatatgtcacttttgattttgccccc |
38343236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 41749385 - 41749441
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||| ||||||||| | ||||||||| |||||||| |||| ||||||| |
|
|
| T |
41749385 |
tgggttaataggcctttaccccttgtaatataggtcacttttgattttctcccctgt |
41749441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 49873006 - 49872974
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
49873006 |
gggttaataggtctttaccccctgtaatatagg |
49872974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 51252342 - 51252286
Alignment:
| Q |
142 |
gggttaataggtcttta-ccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| || || ||||||| |||||||| |
|
|
| T |
51252342 |
gggttaataggtctttatccccctgtaatataggtcatttctggttttcccccctgt |
51252286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 108; Significance: 5e-54; HSPs: 41)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 108; E-Value: 5e-54
Query Start/End: Original strand, 390 - 505
Target Start/End: Complemental strand, 9600181 - 9600066
Alignment:
| Q |
390 |
tttgtatactgaaaattactatagtacccttgaattcctctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaa |
489 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
9600181 |
tttgtatactgaaaattactatagtacccttgaattcccctgattgtttttgtctgctctctctcggtaccccctctcctctccatcatcacatatcaaa |
9600082 |
T |
 |
| Q |
490 |
acaccattcttctcac |
505 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
9600081 |
acaccattcttctcac |
9600066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 81; E-Value: 7e-38
Query Start/End: Original strand, 417 - 505
Target Start/End: Complemental strand, 28395620 - 28395532
Alignment:
| Q |
417 |
ccttgaattcctctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
505 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
28395620 |
ccttgaattcccctgattgtttttgtctgctctctctcggtaccccctctcctctccatcctcatatatcaaaacaccattcttctcac |
28395532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 63; E-Value: 4e-27
Query Start/End: Original strand, 332 - 442
Target Start/End: Complemental strand, 28395734 - 28395622
Alignment:
| Q |
332 |
caggggcagatctctattgagaccccaaggtgctgtggcaccccccaatnnnnnnnnn--tttgtatactgaaaattactatagtacccttgaattcctc |
429 |
Q |
| |
|
||||||| |||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
28395734 |
caggggcggatctctattgagacccccaggtgctgtggcaccccccaataaaaaaaaaaatttgtatactgaaaattactatagtacccttgaattcccc |
28395635 |
T |
 |
| Q |
430 |
tgattgtttttgt |
442 |
Q |
| |
|
||||||||||||| |
|
|
| T |
28395634 |
tgattgtttttgt |
28395622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 143 - 197
Target Start/End: Complemental strand, 27164714 - 27164660
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
27164714 |
ggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
27164660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 42348959 - 42349017
Alignment:
| Q |
140 |
atgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
42348959 |
atgggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
42349017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 2270349 - 2270293
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| || |||||| |||||||||||||||||||||| |
|
|
| T |
2270349 |
tgggttaataggtctttaccccctgtattataggtcacttttggttttgccccctgt |
2270293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 39808648 - 39808703
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
39808648 |
tgggttaataggtctttacccc-tgtaatatagggcacttttggttttgccccctgt |
39808703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 39810144 - 39810088
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
39810144 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
39810088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 1600077 - 1600130
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||||||||||||||||||| ||||||| | |||||||||||||||||||| |
|
|
| T |
1600077 |
gggttaataggtctttaccccctgtaatataagccacttttggttttgccccct |
1600130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 132 - 197
Target Start/End: Complemental strand, 40702077 - 40702012
Alignment:
| Q |
132 |
aaaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| ||| ||||||||||| ||||||||||| ||||||||| ||||||| |||||||||||||| |
|
|
| T |
40702077 |
aaaaaattaagggttaataggcctttaccccctgtaatataggtcacttttcgttttgccccctgt |
40702012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 27163116 - 27163172
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
27163116 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttggcccctgt |
27163172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 39513867 - 39513922
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
39513867 |
gggttaataggcatttaccccctgtaatataggtcacttttggttttgccccctgt |
39513922 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 31985011 - 31985065
Alignment:
| Q |
142 |
gggttaataggtctttacc-ccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
31985011 |
gggttaataggtctttacctccctgtaatataggtcacttttggttttgccccct |
31985065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 34901503 - 34901557
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| |||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
34901503 |
ggttaataggcttttaccccctgtaatataggtcacttttggttttgccccctgt |
34901557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 42350235 - 42350179
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||| ||| ||||||||||||||||||| |
|
|
| T |
42350235 |
gggttaataggtctttacccccctgtaatatagagcatttttggttttgccccctgt |
42350179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 27987297 - 27987348
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||| |||||| |||| |
|
|
| T |
27987297 |
gggttaataggtctttaccccctataatataggtcattttcggttttccccc |
27987348 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 28044599 - 28044650
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || ||| |||||| |||| |
|
|
| T |
28044599 |
gggttaataggtctttaccccctataatataggtcattttcggttttccccc |
28044650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 31986288 - 31986230
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc--tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| ||||||| |||||||||||||| |
|
|
| T |
31986288 |
tgggttaataggtctttaccccccgtgtaatataggtcacttttagttttgccccctgt |
31986230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 1601673 - 1601727
Alignment:
| Q |
142 |
gggttaataggtctttacccc-ctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
1601673 |
gggttaatagacctttacccctctgtaatatagggcacttttggttttgccccct |
1601727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 3252167 - 3252220
Alignment:
| Q |
145 |
ttaataggtctttacccc-ctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| ||||||||| ||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
3252167 |
ttaataggcctttacccctctataatatagggtactttcggttttgccccctgt |
3252220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 136 - 197
Target Start/End: Original strand, 29309559 - 29309620
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| ||||||||||||||||||||||| ||||||||| || || |||||| |||||||| |
|
|
| T |
29309559 |
atttaagggttaataggtctttaccccctgtaatataggtcatttccggttttcccccctgt |
29309620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 192
Target Start/End: Original strand, 2269041 - 2269093
Alignment:
| Q |
141 |
tgggttaataggtctttacccccta-taatatagggcacttttggttttgccc |
192 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
2269041 |
tgggttaataggtctttacctccttgtaatataggtcacttttggttttgccc |
2269093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 332 - 380
Target Start/End: Complemental strand, 9600246 - 9600198
Alignment:
| Q |
332 |
caggggcagatctctattgagaccccaaggtgctgtggcaccccccaat |
380 |
Q |
| |
|
||||||| ||||||||||||||||| ||||| |||||||||||||||| |
|
|
| T |
9600246 |
caggggcggatctctattgagaccctcaggtgttgtggcaccccccaat |
9600198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 187
Target Start/End: Original strand, 28561435 - 28561479
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttt |
187 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28561435 |
ggttaatagagctttaccccctgtaatatagggcacttttggttt |
28561479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 143 - 187
Target Start/End: Original strand, 28566933 - 28566977
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttt |
187 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28566933 |
ggttaatagagctttaccccctgtaatatagggcacttttggttt |
28566977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 28575169 - 28575117
Alignment:
| Q |
142 |
gggttaataggtctttacc-ccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
28575169 |
gggttaataggactttaccaccctgtaatatagggcacttttggttttccccc |
28575117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 132 - 172
Target Start/End: Original strand, 43400661 - 43400701
Alignment:
| Q |
132 |
aaaaatttatgggttaataggtctttaccccctataatata |
172 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| ||||||| |
|
|
| T |
43400661 |
aaaaatttaagggttaataggtctttaccccctgtaatata |
43400701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 43945168 - 43945224
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| | || ||| |||||| |||||||| |
|
|
| T |
43945168 |
tgggttaataggtctttaccccctgtaatatatgtcattttcggtttttccccctgt |
43945224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 14329657 - 14329602
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||| |||||| | |||||| |
|
|
| T |
14329657 |
gggttaataggtctttaccccctgtaatataggtcattttcggttttcctccctgt |
14329602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 39515179 - 39515124
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||| |||| ||||||||| |||||||||||| |||||||| |
|
|
| T |
39515179 |
gggttaataggcctttactccctgtaatataggtcacttttggtttgaccccctgt |
39515124 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 140 - 174
Target Start/End: Complemental strand, 960556 - 960522
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
960556 |
atgggttaataggtctttaccccctgtaatatagg |
960522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 34985379 - 34985333
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || || ||||||| |
|
|
| T |
34985379 |
gggttaataggtctttaccccctgtaatataggtcatttctggtttt |
34985333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 27543683 - 27543650
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
27543683 |
tgggttaataggtctttaccccctgtaatatagg |
27543650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 37402484 - 37402537
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||||| | ||||||||||| |||||||| ||||||||||||| |||||| |
|
|
| T |
37402484 |
gggttaataagcctttaccccctgcaatataggtcacttttggttttcccccct |
37402537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 1601311 - 1601259
Alignment:
| Q |
142 |
gggttaataggtcttta-ccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||| ||||| |||||| ||||||||| |||||||| ||||||||| |
|
|
| T |
1601311 |
gggttaataggcctttacccccctctaatataggacacttttgattttgcccc |
1601259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 6105550 - 6105610
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||| |||||||| | |||||||| ||||||||||||||| |||||| |
|
|
| T |
6105550 |
tttatgggttaatagtgttttaccccgtgcaatataggacacttttggttttgctccctgt |
6105610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 6819195 - 6819251
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||| | |||||||| ||||||||||||| |||||||| |
|
|
| T |
6819195 |
gggttaataggcctttacccccctgcaatataggtcacttttggttttcccccctgt |
6819251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 12330333 - 12330365
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
12330333 |
gggttaataggtctttaccccctgtaatatagg |
12330365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 25277763 - 25277731
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
25277763 |
gggttaataggtctttaccccctgtaatatagg |
25277731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 163 - 195
Target Start/End: Complemental strand, 39683044 - 39683012
Alignment:
| Q |
163 |
ctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
39683044 |
ctataatatagggcacttttgattttgccccct |
39683012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 41708823 - 41708883
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| |||||||| | ||||||||||| ||||||||| || |||||||||| |||||||| |
|
|
| T |
41708823 |
tttaagggttaatggtgctttaccccctgtaatataggtcatttttggtttttccccctgt |
41708883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 53; Significance: 3e-21; HSPs: 40)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 53; E-Value: 3e-21
Query Start/End: Original strand, 141 - 193
Target Start/End: Original strand, 30796578 - 30796630
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30796578 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
30796630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 15061880 - 15061825
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
15061880 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
15061825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 21776965 - 21776908
Alignment:
| Q |
141 |
tgggttaataggtctttacccc-ctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
21776965 |
tgggttaataggtctttacccctctgtaatatagggcacttttggttttgccccctgt |
21776908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 11957706 - 11957650
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
11957706 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
11957650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 194
Target Start/End: Original strand, 15615103 - 15615155
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccc |
194 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
15615103 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgtcccc |
15615155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 41064144 - 41064200
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
41064144 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
41064200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 37274748 - 37274803
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37274748 |
gggttaatagagctttaccccctataatatagggtacttttggttttgccccctgt |
37274803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 143 - 197
Target Start/End: Complemental strand, 13948638 - 13948584
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
13948638 |
ggttaataggcctttacctcctgtaatatagggcacttttggttttgccccctgt |
13948584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 28819537 - 28819591
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
28819537 |
ggttaataggcctttaccccctgtaatataggtcacttttggttttgccccctgt |
28819591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 11956134 - 11956195
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| |||||||||||||||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
11956134 |
tttaagggttaataggtctttacccccctgtaatatagggcacttttggttttggcccctgt |
11956195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 15060158 - 15060219
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
15060158 |
tttaagggttaataggtctttacccccctgtaatataggacacttttggttttgccccctgt |
15060219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 41065719 - 41065658
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| |||||||||||||||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
41065719 |
tttaagggttaataggtctttacccccctgtaatatagggcacttttggttttggcccctgt |
41065658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 15616557 - 15616501
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
15616557 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgccccctgt |
15616501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 9751733 - 9751678
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
9751733 |
gggttaataggcttttaccccctgtaatataggtcacttttggttttgccccctgt |
9751678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 30798635 - 30798580
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| ||| ||||||||||||| |
|
|
| T |
30798635 |
gggttaataggtctttaccccccttaatatagggcactattgattttgccccctgt |
30798580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 11890161 - 11890101
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| |||||||||||| ||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
11890161 |
atttttgggttaataggcctttacccc-tgtaatataggtcacttttggttttgccccctgt |
11890101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 143 - 195
Target Start/End: Original strand, 10011619 - 10011671
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||||||||| ||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
10011619 |
ggttaataggtctttatcccgtgtaatataggacacttttggttttgccccct |
10011671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 133 - 193
Target Start/End: Complemental strand, 11439862 - 11439803
Alignment:
| Q |
133 |
aaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||| ||||||||||||||||| | ||| |||||||| ||||||||||||||||||| |
|
|
| T |
11439862 |
aaaattta-gggttaataggtctttatctcctgtaatatagagcacttttggttttgcccc |
11439803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 136 - 195
Target Start/End: Complemental strand, 10012869 - 10012810
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||| |||||||||||||||||| || || |||||||||| ||||||||||||| ||||| |
|
|
| T |
10012869 |
atttttgggttaataggtctttatcctctgtaatatagggtacttttggttttgtcccct |
10012810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 11438339 - 11438394
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| |||||||||||||| |||||| |
|
|
| T |
11438339 |
gggttaatagagctttaccccctgtaatatagggtacttttggttttgctccctgt |
11438394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 137 - 195
Target Start/End: Original strand, 19599965 - 19600024
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||| ||||||||||| |||||||||| | ||||||||| |||||||||||||||||||| |
|
|
| T |
19599965 |
tttaagggttaataggcctttacccccctgtaatataggtcacttttggttttgccccct |
19600024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 26888514 - 26888459
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
26888514 |
gggttaatagtgttttaccctctataatataggtcacttttggttttgccccctgt |
26888459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 35599311 - 35599368
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
35599311 |
tgggttaatagacctttacccccctgtaatataggtcacttttggttttgccccctgt |
35599368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 36993046 - 36992985
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| || || |||||| |||||||| |
|
|
| T |
36993046 |
atttatgggttaataggtctttaccctctgtaatataggtcatttccggtttttccccctgt |
36992985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 190
Target Start/End: Complemental strand, 8368054 - 8368006
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgc |
190 |
Q |
| |
|
|||||||||||||||||||| || || ||||| |||||||||||||||| |
|
|
| T |
8368054 |
gggttaataggtctttaccctctgtagtatagagcacttttggttttgc |
8368006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 9750447 - 9750503
Alignment:
| Q |
142 |
gggttaataggtctttacccccta-taatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||||||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
9750447 |
gggttaataggcctttacccccttgtaatataggtcacttttggttttgtcccctgt |
9750503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 136 - 188
Target Start/End: Original strand, 12330848 - 12330900
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||| ||||||| ||||| ||||||||| || |||||||||| |
|
|
| T |
12330848 |
atttatgggttaatatgtctttaacccctgtaatataggtcatttttggtttt |
12330900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 12399644 - 12399588
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | ||| |||||| |||||||| |
|
|
| T |
12399644 |
tgggttaataggtctttaccccctgtaatataggttattttcggttttcccccctgt |
12399588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 889068 - 889123
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| ||| ||||||||| || ||||| |
|
|
| T |
889068 |
gggttaataggtctttaccccttgtaatataggccacatttggttttccctcctgt |
889123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 26034845 - 26034900
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||| || |||||||| || |||||||||| |||||||| |
|
|
| T |
26034845 |
gggttaataggtctttaccctctgcaatataggtcatttttggtttttccccctgt |
26034900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 143 - 193
Target Start/End: Complemental strand, 35600595 - 35600544
Alignment:
| Q |
143 |
ggttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| |||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
35600595 |
ggttaataggcctttacccccctgtaatataggtcacttttggttttgcccc |
35600544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 38482318 - 38482373
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || || ||||||| | |||||| |
|
|
| T |
38482318 |
gggttaataggtctttaccccctgtaatataggtcaattctggttttcctccctgt |
38482373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 142 - 187
Target Start/End: Original strand, 15395544 - 15395589
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttt |
187 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||| |||||||||||| |
|
|
| T |
15395544 |
gggttaataggtttttaccccctgtaaaataggtcacttttggttt |
15395589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 142 - 190
Target Start/End: Complemental strand, 19601324 - 19601275
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgc |
190 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
19601324 |
gggttaataggcctttacccccctgtaatataggtcacttttggttttgc |
19601275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 144 - 193
Target Start/End: Complemental strand, 23932510 - 23932461
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||| |||| |
|
|
| T |
23932510 |
gttaataggtctttatcccctgcaatataggtcacttttggtttttcccc |
23932461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 137 - 193
Target Start/End: Original strand, 4060454 - 4060510
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||| |||||||||| ||||||||||| |||||||| | ||| ||||||||||||| |
|
|
| T |
4060454 |
tttaagggttaatagagctttaccccctctaatatagagtactcttggttttgcccc |
4060510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 10976804 - 10976772
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
10976804 |
gggttaataggtctttaccccctgtaatatagg |
10976772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 22551522 - 22551554
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
22551522 |
gggttaataggtctttaccccctgtaatatagg |
22551554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 29104444 - 29104476
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
29104444 |
gggttaataggtctttaccccctgtaatatagg |
29104476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 34407952 - 34407904
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||| |||| |||||||||| ||||||| | ||||||||||||| |
|
|
| T |
34407952 |
atgggttaaaaggtatttaccccctgtaatataagtcacttttggtttt |
34407904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 1e-20; HSPs: 58)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 54554383 - 54554438
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
54554383 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
54554438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 434 - 502
Target Start/End: Complemental strand, 17626740 - 17626671
Alignment:
| Q |
434 |
tgtttttgtctg-ctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttct |
502 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||| | |||||||| |
|
|
| T |
17626740 |
tgtttttgtctgtctctctctcggtaccccctttcctctccatcctcacatatcaaaacgcgattcttct |
17626671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 50881479 - 50881424
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
50881479 |
gggttaataggtctttaccccctgtaatataggccacttttggttttgccccctgt |
50881424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 144 - 197
Target Start/End: Complemental strand, 51164075 - 51164022
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||| ||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
51164075 |
gttaataggcctttaccccctataatataggtcacttttggttttgccccctgt |
51164022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 12566996 - 12566940
Alignment:
| Q |
142 |
gggttaataggtctttacccccta-taatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
12566996 |
gggttaataggtctttacccccttgtaatatagggcacttttggttttgccccctgt |
12566940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 34027252 - 34027196
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
34027252 |
tgggttaataggcctttaccccctgtaatataggtcacttttggttttgccccctgt |
34027196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 54555409 - 54555353
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
54555409 |
tgggttaataagtctttaccccctgtaatatatggcacttttggttttgccccctgt |
54555353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 20962194 - 20962249
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| |||||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20962194 |
gggttaatagatctttaccccctgtaatatatggcacttttggttttgccccctgt |
20962249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 446 - 491
Target Start/End: Complemental strand, 20618569 - 20618524
Alignment:
| Q |
446 |
ctctctctcggtaccccctctcctctccatcctcacatatcaaaac |
491 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
20618569 |
ctctctctcggtaccccctctcctctccctcctcacatatcaaaac |
20618524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 20963758 - 20963701
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||||||||||||| |||||||||||| |
|
|
| T |
20963758 |
tgggttaataggtctttacccccctgtaatatagggcacttttggctttgccccctgt |
20963701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 34741448 - 34741395
Alignment:
| Q |
145 |
ttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
34741448 |
ttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
34741395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 29248237 - 29248297
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| ||||||||||||| ||| |||| |
|
|
| T |
29248237 |
tttaagggttaataggtctttaccccctgtaatataggacacttttggttttacccgctgt |
29248297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 29249767 - 29249711
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
29249767 |
gggttaataggtctttacccccctgtaatatagggaacttttggttttgccccctgt |
29249711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 34739888 - 34739944
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||| ||||||| |
|
|
| T |
34739888 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttggcccctgt |
34739944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 142 - 189
Target Start/End: Complemental strand, 43860970 - 43860923
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttg |
189 |
Q |
| |
|
||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
43860970 |
gggttaataggtctttacctcctgtaatatagggcacttttggttttg |
43860923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 550670 - 550724
Alignment:
| Q |
139 |
tatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| || |||| |||||||||| |
|
|
| T |
550670 |
tatgggttaataggtctttaccccctgtaatataggtcatttttagttttgcccc |
550724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 21994328 - 21994382
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |||||||| ||||| ||||||| |
|
|
| T |
21994328 |
ggttaataggtctttaccccctgtaatataggacacttttgattttgtcccctgt |
21994382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 143 - 195
Target Start/End: Complemental strand, 17290032 - 17289980
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||| ||||| |||||| |
|
|
| T |
17290032 |
ggttaataggtctttaccccctataatataggtcattttttgttttcccccct |
17289980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 51752686 - 51752738
Alignment:
| Q |
145 |
ttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||| | |||||||| ||||||||||||| |
|
|
| T |
51752686 |
ttaataggtctttaccccctgtaatatatgacacttttgattttgccccctgt |
51752738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 55500463 - 55500407
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| || ||||||||||||||||||| |
|
|
| T |
55500463 |
gggttaataggtctttacccccctgtaatataggacatttttggttttgccccctgt |
55500407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 50138488 - 50138543
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||| |||||| |||||||| |
|
|
| T |
50138488 |
gggttaataggtctttaccccctgtaatataggtcattttcggtttttccccctgt |
50138543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 139 - 193
Target Start/End: Original strand, 15694456 - 15694510
Alignment:
| Q |
139 |
tatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
15694456 |
tatgggttaataggcctttaccccctgtaatatacaccacttttggttttgcccc |
15694510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 139 - 193
Target Start/End: Complemental strand, 24701261 - 24701207
Alignment:
| Q |
139 |
tatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||| ||||||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
24701261 |
tatgggttaataggcctttaccccctgcaatataggtcacttttggttttccccc |
24701207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 38656112 - 38656066
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||| ||||| |
|
|
| T |
38656112 |
gggttaataggtctttaccccctataatataggtcattttttgtttt |
38656066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 51162077 - 51162131
Alignment:
| Q |
142 |
gggttaataggtcttta-ccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||||||| ||||| |||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
51162077 |
gggttaataggcctttatccccctataatataggtcacttttgattttgccccct |
51162131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 46094303 - 46094242
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||| || || |||||| |||||||| |
|
|
| T |
46094303 |
atttatgggttaataggtctttaccctctgtaatataggtcatttccggtttttccccctgt |
46094242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 50879909 - 50879962
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||||| |||| |
|
|
| T |
50879909 |
gggttaataggtctttacttcctgtaatataggccacttttggttttgctccct |
50879962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 128 - 197
Target Start/End: Complemental strand, 51353504 - 51353435
Alignment:
| Q |
128 |
aatgaaaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| ||||||||| || || ||||||| |||||||| |
|
|
| T |
51353504 |
aatgaaaaattcatgggttaatagtgatttaccccctgtaatataggtcatttctggttttcccccctgt |
51353435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 11861903 - 11861951
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgc |
190 |
Q |
| |
|
|||||||| || ||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
11861903 |
gggttaatgggcctttaccccctgtaatatagagcacttttggttttgc |
11861951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 11862091 - 11862028
Alignment:
| Q |
133 |
aaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| ||||||||||| |||||||| | |||||||| |||||||||||||||||||||| |
|
|
| T |
11862091 |
aaaattta-gggttaataggcctttaccctttgtaatatagaacacttttggttttgccccctgt |
11862028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 144 - 188
Target Start/End: Complemental strand, 12352514 - 12352470
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| ||||||||||||| |
|
|
| T |
12352514 |
gttaataggcctttaccccctgtaatataggtcacttttggtttt |
12352470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 132 - 188
Target Start/End: Complemental strand, 13128492 - 13128436
Alignment:
| Q |
132 |
aaaaatttatgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||| ||| ||||||||||| ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
13128492 |
aaaaacttaagggttaataggcatttaccctctataatataggtcacttttggtttt |
13128436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 190
Target Start/End: Original strand, 14183611 - 14183659
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgc |
190 |
Q |
| |
|
|||||||||| |||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14183611 |
gggttaatagtgttttaccccctctaatatagggcacttttggttttgc |
14183659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 20612969 - 20613021
Alignment:
| Q |
145 |
ttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| ||||||||||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
20612969 |
ttaataggcctttaccccctgcaatataggtcacttttggttttcccccctgt |
20613021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 11563574 - 11563519
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || || ||||||| ||||||| |
|
|
| T |
11563574 |
gggttaataggtctttaccccctgtaatataggtcatttctggttttttcccctgt |
11563519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 21780122 - 21780173
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||| |||||| |||| |
|
|
| T |
21780122 |
gggttaataggtctttaccccctgtaatataggtcattttcggttttccccc |
21780173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 24215798 - 24215743
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || || ||||||| ||||||| |
|
|
| T |
24215798 |
gggttaataggtctttaccccctgtaatataggtcatttctggttttctcccctgt |
24215743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 41331769 - 41331824
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| ||||| |||||||| ||||||||||||| || ||||| |
|
|
| T |
41331769 |
gggttaataggtctttatcccctgcaatataggtcacttttggtttttcctcctgt |
41331824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 188
Target Start/End: Complemental strand, 41332796 - 41332749
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||| |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
41332796 |
tgggttaataggcttttacctcctataatataggtcacttttggtttt |
41332749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 48029415 - 48029469
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||||||||| |||| |||| || ||||||||||||||||||| |
|
|
| T |
48029415 |
gggttaataggcctttaccccctgtaatttaggtca-ttttggttttgccccctgt |
48029469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 134 - 197
Target Start/End: Complemental strand, 50719974 - 50719911
Alignment:
| Q |
134 |
aaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||||||||||| || ||| |||||| || ||||| |
|
|
| T |
50719974 |
aaatttttgggttaatagtgctttaccccctataatataggtcattttcggttttccctcctgt |
50719911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 189
Target Start/End: Complemental strand, 51754257 - 51754210
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttg |
189 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| ||||||||||||| |
|
|
| T |
51754257 |
gggttaatagagctttaccccctgtaatatagggtacttttggttttg |
51754210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 143 - 197
Target Start/End: Complemental strand, 9136460 - 9136406
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| |||| ||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
9136460 |
ggttaataggcatttatcccctgtaatatagatcacttttggttttgccccctgt |
9136406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 330 - 376
Target Start/End: Complemental strand, 17626870 - 17626824
Alignment:
| Q |
330 |
tccaggggcagatctctattgagaccccaaggtgctgtggcaccccc |
376 |
Q |
| |
|
||||||||| |||||||||||||||||| |||| | ||||||||||| |
|
|
| T |
17626870 |
tccaggggcggatctctattgagacccccaggttccgtggcaccccc |
17626824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 20986107 - 20986045
Alignment:
| Q |
135 |
aatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| | ||| ||| |||||||||||||| |
|
|
| T |
20986107 |
aatttaagggttaatagtgttttaccccctataatatatgacaccttttgttttgccccctgt |
20986045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 135 - 197
Target Start/End: Original strand, 24215494 - 24215556
Alignment:
| Q |
135 |
aatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||| ||||||||| |||||||| |||||||||||| | || ||| |||||| |||||||| |
|
|
| T |
24215494 |
aatttaagggttaataagtctttactccctataatatatgtcattttcggttttcccccctgt |
24215556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 9410341 - 9410284
Alignment:
| Q |
141 |
tgggttaataggtctttacccc-ctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
9410341 |
tgggttaatagtgttttacccctctgtaatatagggcacttttggttttgtcccctgt |
9410284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 133 - 197
Target Start/End: Complemental strand, 17696038 - 17695974
Alignment:
| Q |
133 |
aaaatttatgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| |||||||||| |||||||||| | ||||||| | |||||||||||||||||||||| |
|
|
| T |
17696038 |
aaaattta-gggttaatagtcctttacccccctgtaatataagacacttttggttttgccccctgt |
17695974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 54354249 - 54354192
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||| |||||||||| | |||||||| ||||||||||||| |||||||| |
|
|
| T |
54354249 |
tgggttaataggcctttacccccctgcaatataggtcacttttggttttcccccctgt |
54354192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 15695236 - 15695180
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | || |||| |||||||||||||||||||||| |
|
|
| T |
15695236 |
gggttaataggtctttacccccctgtattatacaccacttttggttttgccccctgt |
15695180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 17289742 - 17289798
Alignment:
| Q |
142 |
gggttaataggtcttta-ccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| |||||| |||||||| || |||||||||| |||||||| |
|
|
| T |
17289742 |
gggttaataggtctttatccccctgaaatataggtcatttttggttttcccccctgt |
17289798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 20125475 - 20125443
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
20125475 |
gggttaataggtctttaccccctgtaatatagg |
20125443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 21798332 - 21798388
Alignment:
| Q |
142 |
gggttaataggtcttta-ccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| |||||| ||||||||| || || ||||||| |||||||| |
|
|
| T |
21798332 |
gggttaataggtctttacccccctgtaatataggtcatttctggttttaccccctgt |
21798388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 31110529 - 31110485
Alignment:
| Q |
153 |
tctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||| ||||||||| || |||||||||| |||||||| |
|
|
| T |
31110529 |
tctttaccccctgtaatataggtcatttttggtttttccccctgt |
31110485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 34025914 - 34025966
Alignment:
| Q |
142 |
gggttaataggtctttacccccta-taatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| ||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
34025914 |
gggttaatagacctttacccccttgtaatataggtcacttttggttttgcccc |
34025966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 37273452 - 37273420
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
37273452 |
gggttaataggtctttaccccctgtaatatagg |
37273420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 136 - 183
Target Start/End: Original strand, 45900522 - 45900570
Alignment:
| Q |
136 |
atttatgggttaataggtcttta-ccccctataatatagggcacttttg |
183 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||| || ||||| |
|
|
| T |
45900522 |
atttatgggttaataggtctttacccccctgtaatataggtcatttttg |
45900570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 134 - 174
Target Start/End: Original strand, 51965364 - 51965404
Alignment:
| Q |
134 |
aaatttatgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||| |||||||||||||||||||| |||| ||||||||| |
|
|
| T |
51965364 |
aaattcatgggttaataggtctttactccctgtaatatagg |
51965404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 51; Significance: 5e-20; HSPs: 56)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 51; E-Value: 5e-20
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 16670500 - 16670554
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16670500 |
ggttaataggtctttaccccctgtaatatagggcacttttggttttgccccctgt |
16670554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 433 - 505
Target Start/End: Complemental strand, 1198237 - 1198165
Alignment:
| Q |
433 |
ttgtttttgtctg-ctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
505 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
1198237 |
ttgtttttgtctgtctctctctcggtaccccctctcctccccatcctcacatatcaaaac-gcattcttctcac |
1198165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 142 - 195
Target Start/End: Complemental strand, 38937565 - 38937512
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
38937565 |
gggttaataggtctttaccccctgtaatatagggcacttttggttttgccccct |
38937512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 23835829 - 23835774
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
23835829 |
gggttaataggtctttaccccctgtaatatagggcacttttagttttgccccctgt |
23835774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 328 - 505
Target Start/End: Complemental strand, 1288737 - 1288557
Alignment:
| Q |
328 |
tatccaggggcagatctctattgagaccccaaggtgctgtggcaccccccaatnnnnnnnnn----tttgtatactgaaaattactatagtaccct-tga |
422 |
Q |
| |
|
||||||||||| |||||||||||||||||| |||||| ||||||||||| | | ||||||||||||||| ||||||||||||| || |
|
|
| T |
1288737 |
tatccaggggcggatctctattgagacccccaggtgccgtggcaccccctagtaaaaaaataataatttgtatactgaaaactactatagtaccccctgg |
1288638 |
T |
 |
| Q |
423 |
attc-ctctgattgtttttgtctg-ctctctctcggtaccccctctcctctccatcctcacatatcaaaacaccattcttctcac |
505 |
Q |
| |
|
|||| | || |||||||||||| |||||||||||||| ||||||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
1288637 |
attcacact---tgtttttgtctgtctctctctcggtactccctctcctctccatcctcgcatatcaaaac-gcattcttctcac |
1288557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 1902930 - 1902986
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
1902930 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
1902986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 1904466 - 1904410
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
1904466 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
1904410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 7576325 - 7576381
Alignment:
| Q |
142 |
gggttaataggtcttta-ccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
7576325 |
gggttaataggtctttatccccctgtaatatagggcacttttggttttgccccctgt |
7576381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 23834581 - 23834637
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
23834581 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
23834637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 142 - 195
Target Start/End: Complemental strand, 19686236 - 19686183
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
19686236 |
gggttaatagtgctttaccccctgtaatatagggcacttttggttttgccccct |
19686183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 44366866 - 44366923
Alignment:
| Q |
141 |
tgggttaataggtctttacc-ccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||| | |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
44366866 |
tgggttaataggtctttaactccctgtaatatagggcacttttggttttgccccctgt |
44366923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 7577834 - 7577778
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||||||||| |||||||| |
|
|
| T |
7577834 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttaccccctgt |
7577778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 44242419 - 44242357
Alignment:
| Q |
135 |
aatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| |||||||||||| ||||||| ||| |||||||| |||||||||||||||||||||| |
|
|
| T |
44242419 |
aatttttgggttaataggcctttacctcctgtaatatagatcacttttggttttgccccctgt |
44242357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 38; E-Value: 0.000000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 38815151 - 38815094
Alignment:
| Q |
141 |
tgggttaataggtctttac-cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||| ||||||||||||||||||| |||| |
|
|
| T |
38815151 |
tgggttaataggtctttactcccctgtaatataaggcacttttggttttgccctctgt |
38815094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 18250947 - 18250891
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||| ||||||||||||| ||||| |
|
|
| T |
18250947 |
gggttaataggtctttacccccctgtaatatagggcatttttggttttgcctcctgt |
18250891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 22468282 - 22468226
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
22468282 |
gggttaataggcctttacccccctgtaatataggtcacttttggttttgccccctgt |
22468226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 22474503 - 22474447
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
22474503 |
gggttaataggcctttacccccctgtaatataggtcacttttggttttgccccctgt |
22474447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 38935944 - 38935999
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| ||||||||||||||||| |||| |
|
|
| T |
38935944 |
tgggttaataggtctttacccc-tgtaatataggacacttttggttttgcccactgt |
38935999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 22466982 - 22467037
Alignment:
| Q |
143 |
ggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| | ||||||||| |||||||||||||| ||||||| |
|
|
| T |
22466982 |
ggttaataggtctttacccccctgtaatataggtcacttttggttttgtcccctgt |
22467037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 30371385 - 30371440
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||| |||| ||||||||| || |||||||||| |||||||| |
|
|
| T |
30371385 |
gggttaataggtctttactccctgtaatataggtcatttttggttttcccccctgt |
30371440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 9468584 - 9468522
Alignment:
| Q |
135 |
aatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| ||||| |||||||||||||| || ||| ||||||||||||||| |
|
|
| T |
9468584 |
aatttatgggttaatagtgttttacaccctataatataggtcattttcggttttgccccctgt |
9468522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 38877078 - 38877032
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||| ||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
38877078 |
gggttaatagggctttaccccctgtaatataaggcacttttggtttt |
38877032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 5969723 - 5969780
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||| ||||| ||||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
5969723 |
atgggttaatagagctttatcccctgtaatatagggtacttttggttttgcctcctgt |
5969780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 136 - 189
Target Start/End: Original strand, 15747745 - 15747798
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttg |
189 |
Q |
| |
|
||||| |||||||||| ||||||||||| ||||||||| |||||||||||||| |
|
|
| T |
15747745 |
atttaagggttaatagacctttaccccctgtaatataggtcacttttggttttg |
15747798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 28462556 - 28462495
Alignment:
| Q |
137 |
tttatgggttaataggtcttta-ccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| ||||||||||| ||||| |||||| ||||||||| ||||||||||||||| |||||| |
|
|
| T |
28462556 |
tttaagggttaataggcctttatccccctgtaatataggtcacttttggttttgcaccctgt |
28462495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 132 - 197
Target Start/End: Original strand, 44241087 - 44241152
Alignment:
| Q |
132 |
aaaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| ||| ||||||||||| |||||| |||| ||||||||| || ||||||||||| ||||||| |
|
|
| T |
44241087 |
aaaaaattaagggttaataggactttactccctgtaatataggtcatttttggttttgtcccctgt |
44241152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 189
Target Start/End: Original strand, 18249631 - 18249679
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttg |
189 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| |||||||||||||||| |
|
|
| T |
18249631 |
gggttaataggtctttacccccttgtaatatatggcacttttggttttg |
18249679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 21903923 - 21903979
Alignment:
| Q |
142 |
gggttaataggtctttac-cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| || |||||| ||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
21903923 |
gggttaatggggctttacacccctgtaatatagggcacttttggttttcccccctgt |
21903979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 28141691 - 28141743
Alignment:
| Q |
145 |
ttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||| |||||||||||| ||||||||| ||||||||||||| | |||||| |
|
|
| T |
28141691 |
ttaatagatctttaccccctgtaatataggtcacttttggttttacaccctgt |
28141743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 189
Target Start/End: Complemental strand, 5970810 - 5970764
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttg |
189 |
Q |
| |
|
||||||||||||||||||||| | |||||||||| ||||||||||||| |
|
|
| T |
5970810 |
gggttaataggtctttacccc-tgtaatatagggtacttttggttttg |
5970764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 15749065 - 15749010
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||| ||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
15749065 |
gggttaataggcttttatcccctgtaatatatgtcacttttggttttgccccctgt |
15749010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 17328092 - 17328147
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || || |||||| |||||||| |
|
|
| T |
17328092 |
gggttaataggtctttaccccctgtaatataggtcatttccggttttcccccctgt |
17328147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 22116155 - 22116206
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||| |||||| |||| |
|
|
| T |
22116155 |
gggttaataggtctttaccccctgtaatataggtcattttcggttttccccc |
22116206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 31551528 - 31551583
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||| ||| |||||||||| |||||||||||||| ||| |||| |
|
|
| T |
31551528 |
gggttaatagggctttatcccttataatatagtgcacttttggttttcccctctgt |
31551583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 34635706 - 34635761
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || || |||||| |||||||| |
|
|
| T |
34635706 |
gggttaataggtctttaccccctgtaatataggtcatttccggttttcccccctgt |
34635761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 41305881 - 41305935
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||| ||||||||| ||||| |||| |
|
|
| T |
41305881 |
gggttaataggtctttacccc-tgtaatatagggcgcttttggttctgccctctgt |
41305935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 19493505 - 19493459
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||| |||||| |
|
|
| T |
19493505 |
gggttaataggtctttaccccctgtaatataggtcattttcggtttt |
19493459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 140 - 174
Target Start/End: Original strand, 19641444 - 19641478
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19641444 |
atgggttaataggtctttaccccctgtaatatagg |
19641478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 140 - 174
Target Start/End: Original strand, 19840037 - 19840071
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
19840037 |
atgggttaataggtctttaccccctgtaatatagg |
19840071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 135 - 197
Target Start/End: Complemental strand, 22293607 - 22293545
Alignment:
| Q |
135 |
aatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| |||||||||||| | ||| ||||| ||||||| ||||||||| ||||| |||||||| |
|
|
| T |
22293607 |
aatttttgggttaataggccgttaacccctgtaatataaggcactttttgtttttccccctgt |
22293545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 22535454 - 22535500
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || ||| |||||| |
|
|
| T |
22535454 |
gggttaataggtctttaccccctttaatataggtcattttcggtttt |
22535500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 136 - 174
Target Start/End: Original strand, 29835096 - 29835134
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
29835096 |
atttttgggttaataggtctttaccccctgtaatatagg |
29835134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 140 - 193
Target Start/End: Original strand, 12028196 - 12028249
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||| || ||||| |||| |||| |
|
|
| T |
12028196 |
atgggttaataggtctttacaccctgtaatataggtcatttttgatttttcccc |
12028249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 145 - 193
Target Start/End: Original strand, 15808728 - 15808777
Alignment:
| Q |
145 |
ttaataggtcttta-ccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||| ||||||| |||||||| ||||||||||||| |||| |
|
|
| T |
15808728 |
ttaataggtctttatccccctacaatataggtcacttttggttttccccc |
15808777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 144 - 197
Target Start/End: Complemental strand, 15809430 - 15809377
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||| ||||| |||||||| ||||||||||||| ||||||| |
|
|
| T |
15809430 |
gttaataggtctttatcccctgcaatataggtcacttttggttttcacccctgt |
15809377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 143 - 188
Target Start/End: Original strand, 18701552 - 18701597
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||||||| ||||| ||||||||| || |||||||||| |
|
|
| T |
18701552 |
ggttaataggtctttatcccctgtaatataggtcatttttggtttt |
18701597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 145 - 197
Target Start/End: Original strand, 38875991 - 38876044
Alignment:
| Q |
145 |
ttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||| |||||||||| | ||||||||| ||||||||||||| |||||||| |
|
|
| T |
38875991 |
ttaatagggctttacccccctgtaatataggacacttttggtttttccccctgt |
38876044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 160 - 197
Target Start/End: Complemental strand, 45161420 - 45161383
Alignment:
| Q |
160 |
cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
45161420 |
cccctgtaatatagggcacttttggttttgcctcctgt |
45161383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 134 - 174
Target Start/End: Complemental strand, 9894608 - 9894568
Alignment:
| Q |
134 |
aaatttatgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||||| |||| |
|
|
| T |
9894608 |
aaatttttgggttaatatgtctttaccccctataatttagg |
9894568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 16577404 - 16577372
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
16577404 |
gggttaataggtctttaccccctgtaatatagg |
16577372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 143 - 195
Target Start/End: Complemental strand, 18416729 - 18416677
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||| ||| ||||||||||| |
|
|
| T |
18416729 |
ggttaataagtatttaccccctataatataggctactgttgattttgccccct |
18416677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 25227823 - 25227879
Alignment:
| Q |
142 |
gggttaataggtctttaccc-cctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||| ||| ||||||||| || || ||||||| |||||||| |
|
|
| T |
25227823 |
gggttaataggtctttaccctcctgtaatataggtcatttctggttttcccccctgt |
25227879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 28484646 - 28484594
Alignment:
| Q |
145 |
ttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||| |||| ||||||||| || |||||||||| | |||||| |
|
|
| T |
28484646 |
ttaataggtctttactccctgtaatataggtcatttttggttttccgccctgt |
28484594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 144 - 188
Target Start/End: Complemental strand, 30371651 - 30371607
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || || ||||||| |
|
|
| T |
30371651 |
gttaataggtctttaccccctgtaatataggtcatttctggtttt |
30371607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Complemental strand, 34428922 - 34428890
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
34428922 |
gggttaataggtctttacctcctataatatagg |
34428890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 37147551 - 37147583
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
37147551 |
gggttaataggtctttaccccctgtaatatagg |
37147583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 49; Significance: 8e-19; HSPs: 41)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 14328704 - 14328648
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
14328704 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
14328648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 49; E-Value: 8e-19
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 14421714 - 14421658
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
14421714 |
tgggttaataggtctttaccccctgtaatataggtcacttttggttttgccccctgt |
14421658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 46; E-Value: 5e-17
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 22058337 - 22058280
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
22058337 |
tgggttaataggtctttacccccctgtaatatagggcacttttggttttgccccctgt |
22058280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 137 - 193
Target Start/End: Complemental strand, 3063545 - 3063489
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||| ||||||||||||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
3063545 |
tttaagggttaataggtctttaccccctgtaatataggtcacttttggttttgcccc |
3063489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 24235688 - 24235632
Alignment:
| Q |
142 |
gggttaataggtctttacccc-ctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
24235688 |
gggttaataggtctttacccctctgtaatatagggcacttttggttttgccccctgt |
24235632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 56169 - 56114
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| ||||| ||||||| |
|
|
| T |
56169 |
gggttaataggtctttaccccctgtaatatagggcacttttgattttgtcccctgt |
56114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 131 - 197
Target Start/End: Original strand, 34762172 - 34762237
Alignment:
| Q |
131 |
gaaaaatttatgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||| ||||||||||||||| ||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
34762172 |
gaaaaattta-gggctaataggtctttacctcctgtaatatagggcacttttggttttgctccctgt |
34762237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 12322865 - 12322804
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| |||||||||||||||||||||| | |||||||||||||||||| ||||||||||||| |
|
|
| T |
12322865 |
tttaagggttaataggtctttacccccctgtaatatagggcacttttgattttgccccctgt |
12322804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 22056481 - 22056538
Alignment:
| Q |
141 |
tgggttaataggtctttacc-ccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||| | |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
22056481 |
tgggttaataggtctttaactccctgtaatatagggcacttttggttttgccccctgt |
22056538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 137 - 197
Target Start/End: Original strand, 24234324 - 24234385
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| |||||||||||||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
24234324 |
tttaagggttaataggtctttacccccctgtaatataggacacttttggttttgccccctgt |
24234385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 40; E-Value: 0.0000000000002
Query Start/End: Original strand, 139 - 197
Target Start/End: Original strand, 33483693 - 33483752
Alignment:
| Q |
139 |
tatgggttaataggtctttacc-ccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
33483693 |
tatgggttaataggtctttaccaccctgtaatataggacacttttggttttgccctctgt |
33483752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 14327370 - 14327424
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
14327370 |
ggttaataggcctttaccccctgtaatatacgtcacttttggttttgccccctgt |
14327424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 14420380 - 14420434
Alignment:
| Q |
143 |
ggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| | |||||||||||||||||||||| |
|
|
| T |
14420380 |
ggttaataggcctttaccccctgtaatatacgtcacttttggttttgccccctgt |
14420434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 12321562 - 12321618
Alignment:
| Q |
142 |
gggttaataggtcttta-ccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||| ||||||||||||||| ||||| |
|
|
| T |
12321562 |
gggttaataggtctttatccccctgtaatatagggtacttttggttttgcctcctgt |
12321618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 447 - 491
Target Start/End: Original strand, 15598478 - 15598522
Alignment:
| Q |
447 |
tctctctcggtaccccctctcctctccatcctcacatatcaaaac |
491 |
Q |
| |
|
|||||||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
15598478 |
tctctctcggtaccccctctccactccctcctcacatatcaaaac |
15598522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 141 - 189
Target Start/End: Complemental strand, 23270267 - 23270219
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttg |
189 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
23270267 |
tgggttaataggtctttaccccctttaatataggtcacttttgattttg |
23270219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 22573802 - 22573853
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||| ||||| |||| |
|
|
| T |
22573802 |
gggttaataggtctttaccccctataatataggtcattttttgtttttcccc |
22573853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 142 - 188
Target Start/End: Original strand, 24062167 - 24062213
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || || ||||||| |
|
|
| T |
24062167 |
gggttaataggtctttaccccctataatataggtcatttctggtttt |
24062213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 35; E-Value: 0.0000000002
Query Start/End: Original strand, 135 - 193
Target Start/End: Complemental strand, 29942507 - 29942449
Alignment:
| Q |
135 |
aatttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||| ||||||||||||||||||||||| ||||||||| || || ||||||| |||| |
|
|
| T |
29942507 |
aatttaagggttaataggtctttaccccctgtaatataggtcatttctggttttccccc |
29942449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 140 - 193
Target Start/End: Original strand, 10344048 - 10344101
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| || || ||||||| |||| |
|
|
| T |
10344048 |
atgggttaataggtctttaccccctgtaatataggtcatttctggttttccccc |
10344101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 54806 - 54861
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| || ||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
54806 |
tgggttaataggtcttt-cctcctgtaatataggacacttttggttttgtcccctgt |
54861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 140 - 188
Target Start/End: Original strand, 7922315 - 7922363
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||| ||||| ||||||||| || |||||||||| |
|
|
| T |
7922315 |
atgggttaataggtctttatcccctgtaatataggtcatttttggtttt |
7922363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 5999717 - 5999768
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
5999717 |
gggttaatagagctttaccccctctaatatagggcatttttggttttccccc |
5999768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 6000728 - 6000677
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||||||||||||| |||| |
|
|
| T |
6000728 |
gggttaatagagctttaccccctgtaatatagagcacttttggttttccccc |
6000677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 141 - 188
Target Start/End: Original strand, 13114397 - 13114444
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||| |||||| |
|
|
| T |
13114397 |
tgggttaataggtctttaccccctgtaatataggtcattttcggtttt |
13114444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 30409726 - 30409671
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| ||||||| ||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
30409726 |
gggttaataggcctttacctcctgcaatataggtcacttttggttttcccccctgt |
30409671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 31851758 - 31851813
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| ||||| ||||||||| || ||| |||||| |||||||| |
|
|
| T |
31851758 |
gggttaataggtctttatcccctgtaatataggtcattttcggttttcccccctgt |
31851813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 144 - 186
Target Start/End: Complemental strand, 16130517 - 16130475
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggtt |
186 |
Q |
| |
|
||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
16130517 |
gttaataggtctttaccccttataatatagatcacttttggtt |
16130475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 136 - 197
Target Start/End: Complemental strand, 18984068 - 18984006
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccc-cctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||| ||||||||||| |||||||| ||| |||||||| ||||||||||||| |||||||| |
|
|
| T |
18984068 |
atttaagggttaataggcctttaccctcctgcaatataggtcacttttggttttcccccctgt |
18984006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 22366275 - 22366229
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||||||||||||||||| |||||||| |||||||| |||| |
|
|
| T |
22366275 |
gggttaataggtctttaccccctgcaatataggtcacttttgatttt |
22366229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 144 - 197
Target Start/End: Original strand, 24914440 - 24914494
Alignment:
| Q |
144 |
gttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||| | ||||||||| |||||||| ||||||||||||| |
|
|
| T |
24914440 |
gttaataggtcattacccccctgtaatataggacacttttgattttgccccctgt |
24914494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 26644746 - 26644700
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| ||||||||||||| |
|
|
| T |
26644746 |
gggttaataggtcttttccccttgtaatataggtcacttttggtttt |
26644700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 142 - 188
Target Start/End: Complemental strand, 26750712 - 26750666
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
|||||||||||||||| |||| | ||||||||| ||||||||||||| |
|
|
| T |
26750712 |
gggttaataggtcttttccccttgtaatataggtcacttttggtttt |
26750666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 159 - 197
Target Start/End: Complemental strand, 33485115 - 33485077
Alignment:
| Q |
159 |
ccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
33485115 |
ccccctgtaatatagggtacttttggttttgccccctgt |
33485077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 142 - 187
Target Start/End: Complemental strand, 3120391 - 3120346
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttt |
187 |
Q |
| |
|
||||||||||| ||||||||||| |||||||| |||||||||||| |
|
|
| T |
3120391 |
gggttaataggcctttaccccctgcaatataggtcacttttggttt |
3120346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 137 - 174
Target Start/End: Original strand, 13639504 - 13639541
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||| |||||||||||||||| ||||||||| |
|
|
| T |
13639504 |
tttatgggttagtaggtctttaccccctgtaatatagg |
13639541 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 142 - 187
Target Start/End: Original strand, 16129494 - 16129539
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttt |
187 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
16129494 |
gggttaataagtctttaccccctgtaatatatgtcacttttggttt |
16129539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 24387819 - 24387786
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
24387819 |
tgggttaataggtctttaccccctgtaatatagg |
24387786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 146 - 197
Target Start/End: Original strand, 3062194 - 3062246
Alignment:
| Q |
146 |
taataggtctttacccc-ctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||| ||||||||| || ||||||||| ||||||||||||||||| |||| |
|
|
| T |
3062194 |
taataggcctttacccctctgtaatataggtcacttttggttttgcccactgt |
3062246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 141 - 197
Target Start/End: Original strand, 28583546 - 28583602
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||| |||||||| | ||||||||||||||||||||||| ||||||| |
|
|
| T |
28583546 |
tgggttaatagtgttttaccccgtgtaatatagggcacttttggtttttgcccctgt |
28583602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 193
Target Start/End: Complemental strand, 32614599 - 32614547
Alignment:
| Q |
142 |
gggttaataggtctttac-cccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
||||||||||| |||||| ||||| ||||||| | |||||||||||||||||| |
|
|
| T |
32614599 |
gggttaataggcctttacacccctgtaatatatgtcacttttggttttgcccc |
32614547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 48; Significance: 3e-18; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 10080 - 10135
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
10080 |
gggttaataggtctttaccccctgtaatatagggcacttttagttttgccccctgt |
10135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136 (Bit Score: 48; Significance: 3e-18; HSPs: 3)
Name: scaffold0136
Description:
Target: scaffold0136; HSP #1
Raw Score: 48; E-Value: 3e-18
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 35599 - 35654
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
35599 |
gggttaataggtctttaccccctaaaatataggtcacttttggttttgccccctgt |
35654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136; HSP #2
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 144 - 188
Target Start/End: Complemental strand, 36798 - 36754
Alignment:
| Q |
144 |
gttaataggtctttaccccctataatatagggcacttttggtttt |
188 |
Q |
| |
|
||||||||| ||||||||||||||||||||| || |||||||||| |
|
|
| T |
36798 |
gttaataggcctttaccccctataatataggtcatttttggtttt |
36754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0136; HSP #3
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 693 - 638
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||| || ||||||||| || || ||||||| |||||||| |
|
|
| T |
693 |
gggttaataggtctttaccctctgtaatataggtcatttatggttttcccccctgt |
638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0176 (Bit Score: 45; Significance: 2e-16; HSPs: 1)
Name: scaffold0176
Description:
Target: scaffold0176; HSP #1
Raw Score: 45; E-Value: 2e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 345 - 289
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
345 |
gggttaataggtctttacccccatgtaatatagggcacttttggttttgccccctgt |
289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0725 (Bit Score: 44; Significance: 8e-16; HSPs: 2)
Name: scaffold0725
Description:
Target: scaffold0725; HSP #1
Raw Score: 44; E-Value: 8e-16
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 3914 - 3969
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| |||| |||| |||||||||||||||||||||| |
|
|
| T |
3914 |
gggttaataggtctttaccccctgtaatgtaggacacttttggttttgccccctgt |
3969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0725; HSP #2
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 137 - 197
Target Start/End: Complemental strand, 5020 - 4958
Alignment:
| Q |
137 |
tttatgggttaataggtctttaccccc--tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||| ||||||||| |||||||||||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
5020 |
tttaagggttaataagtctttaccccccctgtaatataggtcacttttggttttgccccctgt |
4958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040 (Bit Score: 43; Significance: 0.000000000000003; HSPs: 2)
Name: scaffold0040
Description:
Target: scaffold0040; HSP #1
Raw Score: 43; E-Value: 0.000000000000003
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 64501 - 64559
Alignment:
| Q |
140 |
atgggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||||| | |||||||||| ||||||||||||||||||||| |
|
|
| T |
64501 |
atgggttaataggtctttacccccctgtaatatagggtacttttggttttgccccctgt |
64559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0040; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 66101 - 66045
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| | |||||||||||||||||||||| |
|
|
| T |
66101 |
gggttaataggtctttacccccctgtaatatatgacacttttggttttgccccctgt |
66045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0804 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 1)
Name: scaffold0804
Description:
Target: scaffold0804; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 2733 - 2789
Alignment:
| Q |
142 |
gggttaataggtctttac-cccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||| ||||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
2733 |
gggttaataggtctttactcccctgtaatatagggcacttttggttttgcctcctgt |
2789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210 (Bit Score: 41; Significance: 0.00000000000005; HSPs: 2)
Name: scaffold0210
Description:
Target: scaffold0210; HSP #1
Raw Score: 41; E-Value: 0.00000000000005
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 4707 - 4763
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||||||||||| ||||| |
|
|
| T |
4707 |
gggttaataggtctttacccccctgtaatatagggcacttttggttttgcctcctgt |
4763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0210; HSP #2
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 140 - 193
Target Start/End: Complemental strand, 5955 - 5901
Alignment:
| Q |
140 |
atgggttaataggtctttaccc-cctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||| | ||| |||||||||||||||||||||||||||| |
|
|
| T |
5955 |
atgggttaataggtctttacactcctgtaatatagggcacttttggttttgcccc |
5901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014 (Bit Score: 39; Significance: 0.0000000000008; HSPs: 3)
Name: scaffold0014
Description:
Target: scaffold0014; HSP #1
Raw Score: 39; E-Value: 0.0000000000008
Query Start/End: Original strand, 142 - 195
Target Start/End: Original strand, 227369 - 227423
Alignment:
| Q |
142 |
gggttaataggtctttacc-ccctataatatagggcacttttggttttgccccct |
195 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||| |||||||||||||||||||| |
|
|
| T |
227369 |
gggttaataggtctttacctccctgtaatataggtcacttttggttttgccccct |
227423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 227 - 331
Target Start/End: Complemental strand, 118620 - 118516
Alignment:
| Q |
227 |
gtagtttagtgttcattgatcttgttggtctaggagtatcatagtttagcgttggagtaattatattttgcttttatttactttcatagtaaaggatagt |
326 |
Q |
| |
|
||||||| |||||||| |||||| | ||||||||||| ||| | |||| ||| |||||||||| |||| ||||| ||||| ||||||| ||||||| | |
|
|
| T |
118620 |
gtagtttggtgttcatgaatcttgctagtctaggagtaccattgcttagtgttagagtaattatgtttttcttttcgttactatcatagttaaggataat |
118521 |
T |
 |
| Q |
327 |
gtatc |
331 |
Q |
| |
|
||||| |
|
|
| T |
118520 |
gtatc |
118516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0014; HSP #3
Raw Score: 36; E-Value: 0.00000000005
Query Start/End: Original strand, 141 - 197
Target Start/End: Complemental strand, 228646 - 228588
Alignment:
| Q |
141 |
tgggttaataggtctttaccccc--tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| | ||||||||| ||||||| |||||||||||||| |
|
|
| T |
228646 |
tgggttaataggtctttaccccccgtgtaatataggtcacttttagttttgccccctgt |
228588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0228 (Bit Score: 37; Significance: 0.00000000001; HSPs: 3)
Name: scaffold0228
Description:
Target: scaffold0228; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 8082 - 8134
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
8082 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgcccc |
8134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0228; HSP #2
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 15664 - 15716
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
15664 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgcccc |
15716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0228; HSP #3
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 142 - 193
Target Start/End: Original strand, 25616 - 25668
Alignment:
| Q |
142 |
gggttaataggtctttaccccc-tataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||| |||||||||||||||||| |
|
|
| T |
25616 |
gggttaataggtctttacccccctgtaatataggacacttttggttttgcccc |
25668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0933 (Bit Score: 34; Significance: 0.0000000007; HSPs: 1)
Name: scaffold0933
Description:
Target: scaffold0933; HSP #1
Raw Score: 34; E-Value: 0.0000000007
Query Start/End: Original strand, 136 - 193
Target Start/End: Complemental strand, 2781 - 2724
Alignment:
| Q |
136 |
atttatgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||| |||||||||| |||||||||| |||||||| |||||||| |
|
|
| T |
2781 |
atttatgggttaatagagttttaccccctgtaatatagggtacttttggatttgcccc |
2724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 33; Significance: 0.000000003; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 33; E-Value: 0.000000003
Query Start/End: Original strand, 141 - 193
Target Start/End: Original strand, 26307 - 26359
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttttgcccc |
193 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||| |||||| |||| |
|
|
| T |
26307 |
tgggttaataggtctttaccccctgtaatataggtcattttcggttttccccc |
26359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0769 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0769
Description:
Target: scaffold0769; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Complemental strand, 4208 - 4153
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| || || |||||| |||||||| |
|
|
| T |
4208 |
gggttaataggtctttaccccctgtaatataggtcatttccggttttcccccctgt |
4153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 142 - 197
Target Start/End: Original strand, 15872 - 15927
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||| ||||| ||||||| | ||||||| |||||| ||||||| |
|
|
| T |
15872 |
gggttaataggtctttatcccctgtaatatatgacactttttgttttgtcccctgt |
15927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 32; Significance: 0.00000001; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 32; E-Value: 0.00000001
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 23685 - 23740
Alignment:
| Q |
143 |
ggttaataggtctttaccccc-tataatatagggcacttttggttttgccccctgt |
197 |
Q |
| |
|
||||||||||||||||||||| | ||||||| | |||||||| ||||||||||||| |
|
|
| T |
23685 |
ggttaataggtctttacccccatgtaatataagacacttttgattttgccccctgt |
23740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0384 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0384
Description:
Target: scaffold0384; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 141 - 187
Target Start/End: Complemental strand, 4485 - 4439
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagggcacttttggttt |
187 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| || ||| ||||| |
|
|
| T |
4485 |
tgggttaataggtctttaccccctgtaatataggtcattttcggttt |
4439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0177 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0177
Description:
Target: scaffold0177; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 254 - 324
Target Start/End: Original strand, 29985 - 30054
Alignment:
| Q |
254 |
gtctaggagtatcatagtttagcgttggagtaattatattttgcttttatttactttcatagtaaaggata |
324 |
Q |
| |
|
||||||||||| ||||| |||| ||||||||||||| |||| ||||| |||||| ||||||| ||||||| |
|
|
| T |
29985 |
gtctaggagtaccatagcttagtattggagtaattatgtttt-cttttctttactatcatagttaaggata |
30054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0031 (Bit Score: 31; Significance: 0.00000005; HSPs: 1)
Name: scaffold0031
Description:
Target: scaffold0031; HSP #1
Raw Score: 31; E-Value: 0.00000005
Query Start/End: Original strand, 140 - 174
Target Start/End: Original strand, 1825 - 1859
Alignment:
| Q |
140 |
atgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||| |
|
|
| T |
1825 |
atgggttaataggtctttaccccctgtaatatagg |
1859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0142 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: scaffold0142
Description:
Target: scaffold0142; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 141 - 174
Target Start/End: Complemental strand, 34884 - 34851
Alignment:
| Q |
141 |
tgggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| |
|
|
| T |
34884 |
tgggttaataggtctttaccccctgtaatatagg |
34851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0032 (Bit Score: 29; Significance: 0.0000007; HSPs: 1)
Name: scaffold0032
Description:
Target: scaffold0032; HSP #1
Raw Score: 29; E-Value: 0.0000007
Query Start/End: Original strand, 142 - 174
Target Start/End: Original strand, 91050 - 91082
Alignment:
| Q |
142 |
gggttaataggtctttaccccctataatatagg |
174 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
91050 |
gggttaataggtctttaccccctgtaatatagg |
91082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University