View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20783_high_132 (Length: 209)

Name: NF20783_high_132
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20783_high_132
NF20783_high_132
[»] chr3 (1 HSPs)
chr3 (15-191)||(48332537-48332713)


Alignment Details
Target: chr3 (Bit Score: 173; Significance: 3e-93; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 173; E-Value: 3e-93
Query Start/End: Original strand, 15 - 191
Target Start/End: Original strand, 48332537 - 48332713
Alignment:
15 aagaagcaggggagttgaactcacgtatgaatgcgaataagatttagaggtatcaatatgatttcatcacttaccactattatacacatacagatggagt 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48332537 aagaagcaggggagttgaactcacgtatgaatgcgaataagatttagaggtatcaatatgatttcatcacttaccactattatacacatacagatggagt 48332636  T
115 agactcttatgagttatcaatataaggaatcatgcaagtatcagccagggaaacttggcaaggcagtcgataatata 191  Q
     ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48332637 ggactcttatgagttatcaatataaggaatcatgcaagtatcagccagggaaacttggcaaggcagtcgataatata 48332713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University