View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_high_42 (Length: 343)
Name: NF20783_high_42
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_high_42 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 118; Significance: 4e-60; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 118; E-Value: 4e-60
Query Start/End: Original strand, 195 - 312
Target Start/End: Complemental strand, 4508484 - 4508367
Alignment:
| Q |
195 |
gattttattgaataatactaacaagtgtctttgaaattttgttttaattagaaaagttcaatttcttaaaagttcaaaattcattttttaatagaaaatt |
294 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4508484 |
gattttattgaataatactaacaagtgtctttgaaattttgttttaattagaaaagttcaatttcttaaaagttcaaaattcattttttaatagaaaatt |
4508385 |
T |
 |
| Q |
295 |
gatagtttttcttcaata |
312 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4508384 |
gatagtttttcttcaata |
4508367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 117; E-Value: 1e-59
Query Start/End: Original strand, 18 - 158
Target Start/End: Complemental strand, 4513244 - 4513104
Alignment:
| Q |
18 |
ctatgtatgcaagatatataaattgtgttacttgaggtttgaaatctagtgtaaattattgcacatgaagaaagcaaaatcgaaaggatgaaaatgtgac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||| |||||||||||||||||||| |
|
|
| T |
4513244 |
ctatgtatgcaagatatataaattgtgttacttgaggtttgaaatctagtgtaaattattgcacatgaaggaagcgaaagcgaaaggatgaaaatgtgac |
4513145 |
T |
 |
| Q |
118 |
ataaatgagtctcttttgctttccgacatgcaaaaccacct |
158 |
Q |
| |
|
|| ||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
4513144 |
atgaatgagtctctttcgctttccgacatgccaaaccacct |
4513104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University