View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_high_60 (Length: 310)
Name: NF20783_high_60
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_high_60 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 163 - 285
Target Start/End: Original strand, 3064314 - 3064436
Alignment:
| Q |
163 |
gataacttgtgatagatagatagaggaacagactcagtttcttcttagacttggatttcttttttgttcggcttttgctgcctccacccatgggaacgaa |
262 |
Q |
| |
|
|||||||| |||||| |||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3064314 |
gataacttctgataggtagagacaggaacagactcagtttcttcttagacttggatttcttttttgttcggcttttgctgcctccacccatgggaacgaa |
3064413 |
T |
 |
| Q |
263 |
cgggaatggaaatttcaccctaa |
285 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
3064414 |
cgggaatggaaatttcaccctaa |
3064436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 34 - 100
Target Start/End: Original strand, 3064198 - 3064264
Alignment:
| Q |
34 |
tagttaaaattaaacacacctgacgataaatctgatcataaatatattgacgttcagaagatgctac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
3064198 |
tagttaaaattaaacacacctgacgataaatctgatcataaatagattgacgttcagaagatgctac |
3064264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University