View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_high_71 (Length: 287)
Name: NF20783_high_71
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_high_71 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 18 - 165
Target Start/End: Original strand, 3311110 - 3311257
Alignment:
| Q |
18 |
caagaaagagacactactcttaaatgctcctttgcttttcccatttgtgcaaccgaaaatatcagtataatcatcaactaacacaccccaccaccctcat |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3311110 |
caagaaagagacactactcttaaatgctcctttgcttttcccacttgcgcaaccgaaaatatcagtataatcatcaactaacacaccccaccaccatcat |
3311209 |
T |
|
| Q |
118 |
tctaggatgtttaatgggtgccttttagggtcgtcgatattacataat |
165 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||||||||||||| |
|
|
| T |
3311210 |
tctaggttgtttaatgggtaacttttagggttgtcgatattacataat |
3311257 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 144 - 213
Target Start/End: Original strand, 3311280 - 3311348
Alignment:
| Q |
144 |
agggtcgtcgatattacataatcgaaagggttatgttaatcacttgaatgacggagaaatgatatttgta |
213 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||||||||| || ||||||||||| ||||||||| |
|
|
| T |
3311280 |
agggttgtcgatattacataattgaaagggttatgttaatcacttaaacgacggagaaat-atatttgta |
3311348 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University