View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_high_77 (Length: 274)
Name: NF20783_high_77
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_high_77 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 237; Significance: 1e-131; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 13118798 - 13119054
Alignment:
| Q |
1 |
attgtctcacccttcttaaaatctcctgttttgaatccttctattgctgtctgtactgccaaaggcaaacttgcagcttcctcaaatgaaagacattttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13118798 |
attgtctcacccttcttaaaatctcctgttttgaatccttctattgctgtctgtactgccaaaggcaaacttgcagcttcctcaaatgaaagacattttg |
13118897 |
T |
 |
| Q |
101 |
gttttcttgcaactaagttctcttccacaacaatgaattgtgccaatgttccaagctgctttggtttttccatactgttgaaatcttgtatgtttccata |
200 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13118898 |
gttttcttgcaactaacttctcttccacaacaatgaattgtgccaatgttccaagctgctttggtttttccatactgttgaaatcttgtatgtttccata |
13118997 |
T |
 |
| Q |
201 |
cacttcatcacctatgtcaaattttttgacattcattccttttcctatcaccacacc |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||||||| || |||||||| |
|
|
| T |
13118998 |
cacttcatcacctatgtcaaattttttgacattaactccttttccgataaccacacc |
13119054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 13008648 - 13008392
Alignment:
| Q |
1 |
attgtctcacccttcttaaaatctcctgttttgaatccttctattgctgtctgtactgccaaaggcaaacttgcagcttcctcaaatgaaagacattttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | |
|
|
| T |
13008648 |
attgtctcacccttcttaaaatctcctgttttgaatccttctattgctgtctgtactgccaaaggcaaacttgcagcttcctcaaatgaaagacgtttag |
13008549 |
T |
 |
| Q |
101 |
gttttcttgcaactaagttctcttccacaacaatgaattgtgccaatgttccaagctgctttggtttttccatactgttgaaatcttgtatgtttccata |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13008548 |
gttttcttgcaactaagttctcttccacaacaatgaattgtgccaatgttccaagctgctttggtttttccatactgttgaaatcttgtatgtttccata |
13008449 |
T |
 |
| Q |
201 |
cacttcatcacctatgtcaaattttttgacattcattccttttcctatcaccacacc |
257 |
Q |
| |
|
|||||||||||||||||||||||||||||||| | ||||||||| || |||||||| |
|
|
| T |
13008448 |
gacttcatcacctatgtcaaattttttgacattaactccttttccgataaccacacc |
13008392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University