View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_high_92 (Length: 251)
Name: NF20783_high_92
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_high_92 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 5 - 238
Target Start/End: Complemental strand, 45148021 - 45147789
Alignment:
| Q |
5 |
ttattaccctttgtaattgtctgctatggctggaagnnnnnnnnncgttgtttttcaactcaccgacgatgaagccgaagaagataaaagggatggaagg |
104 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||| || |||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
45148021 |
ttattaccctttgtaattgtctgccatggctggaagaaaaaaaa-cgctgtttttcaactcaccgacgatgaagccgaagaagataaaggggatggaagg |
45147923 |
T |
|
| Q |
105 |
ttaccagcgagaaatcttcgctctcggtaatcctgtctgccattgttccaatttttacgtttagccgattgtaacccaattcatttttcacggcgagtcg |
204 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
45147922 |
ttaccagcaagaaatcttcgctctcggtaatcttgtctgccattgttccaatttttacgtttagccgatggtaacccaattcatttttcacggcgagtcg |
45147823 |
T |
|
| Q |
205 |
gtgagtcactcacctagttgccctacttgcttcc |
238 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| |
|
|
| T |
45147822 |
gtgagtcactcacctagttggcctacttgcttcc |
45147789 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University