View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_low_110 (Length: 238)
Name: NF20783_low_110
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_low_110 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 190; Significance: 1e-103; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 20 - 220
Target Start/End: Complemental strand, 39164404 - 39164201
Alignment:
| Q |
20 |
ctgtgggtaacaggatatttttagcaagttttctttaaatggcaggaaaagacattatatctctctcattaagagcgt---aatatagctaatattaatg |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
39164404 |
ctgtgggtaacaggatatttttagcaagttttctttaaatggcaggaaaagacattatatctctctcattaagagcgtgtaaatatagctaatattaatg |
39164305 |
T |
 |
| Q |
117 |
aggacttttgtagcgagagcaatccttgaagattgataaacctgcaattatttgttaatacgcactgcatgcatatatttacacacaaaataatatgagt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39164304 |
aggacttttgtagcgagagcaatccttgaagattgataaacctgcaattatttgttaatacgcactgcatgcatatatttacacacaaaataatatgagt |
39164205 |
T |
 |
| Q |
217 |
tatt |
220 |
Q |
| |
|
|||| |
|
|
| T |
39164204 |
tatt |
39164201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University