View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_low_112 (Length: 237)
Name: NF20783_low_112
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_low_112 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 25626636 - 25626858
Alignment:
| Q |
1 |
tgaaattggaaggacctttcacaaggtaggatttgatggtgttgattatgtgccataggccaagaaatgtgagggctaacccttgcactaagtgtgctat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25626636 |
tgaaattggaaggacctttcacaaggtaagatttgatggtgttgattatgtgccataggccaagaaatgtgagggctaacccttgcactaagtgtgctat |
25626735 |
T |
|
| Q |
101 |
aaacaagtccatagcaacttct-aattttttcagaatacaaacattatttaacttggtttctttatttaaatatatgaaggcattaggaacatattgctt |
199 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
25626736 |
aaacaagtccatagcaacttctaaattttttcagaatacaaacattatttaacttggtttctttatttaaatatacgaaggcattaggaacatattgctt |
25626835 |
T |
|
| Q |
200 |
gcacggaacaaggtgcttcatat |
222 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
25626836 |
gcacggaacaaggtgcttcatat |
25626858 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University