View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_low_123 (Length: 224)
Name: NF20783_low_123
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_low_123 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 1 - 176
Target Start/End: Original strand, 40991412 - 40991587
Alignment:
| Q |
1 |
ataaactaactctctgaggcacatgtatcagagttcgttaagtacttataagcaaatgaacaaatccatgtccatgagacggttaatttgaccttataac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40991412 |
ataaactaactctctgaggcacatgtatcagagttcgttaagtacttataagcaaatgaacaaatccatgtccatgagacggttaatttgaccttataac |
40991511 |
T |
 |
| Q |
101 |
ttcaaaggtcagaggtcaaaggtcaaatttcatccgagacggttgtaaaatgactattagtgtcactttaatcaat |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40991512 |
ttcaaaggtcagaggtcaaaggtcaaatttcatcagagacggttgtaaaatgactattagtgtcactttaatcaat |
40991587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 136 - 169
Target Start/End: Original strand, 16981733 - 16981766
Alignment:
| Q |
136 |
gagacggttgtaaaatgactattagtgtcacttt |
169 |
Q |
| |
|
||||| |||||||||||||||||||||||||||| |
|
|
| T |
16981733 |
gagaccgttgtaaaatgactattagtgtcacttt |
16981766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 139 - 171
Target Start/End: Original strand, 30354701 - 30354733
Alignment:
| Q |
139 |
acggttgtaaaatgactattagtgtcactttaa |
171 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
30354701 |
acggttgtaaaatgaccattagtgtcactttaa |
30354733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 138 - 170
Target Start/End: Complemental strand, 30639378 - 30639346
Alignment:
| Q |
138 |
gacggttgtaaaatgactattagtgtcacttta |
170 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
30639378 |
gacggttgtaaaatgactatttgtgtcacttta |
30639346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University