View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_low_126 (Length: 217)
Name: NF20783_low_126
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_low_126 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 67; Significance: 6e-30; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 67; E-Value: 6e-30
Query Start/End: Original strand, 18 - 84
Target Start/End: Original strand, 32510915 - 32510981
Alignment:
| Q |
18 |
caaaacctattcatgtgaacaaaaagtgatttggccgagtgattcttggaattgtgatcacagtgct |
84 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32510915 |
caaaacctattcatgtgaacaaaaagtgatttggccgagtgattcttggaattgtgatcacagtgct |
32510981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 147 - 204
Target Start/End: Original strand, 32511044 - 32511101
Alignment:
| Q |
147 |
attagtgaattcaataatctaagaccactccctccctactgtatcttaattgcttcat |
204 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
32511044 |
attagtgaattcaataatctgagaccactccctccctactgtatcttaactgcttcat |
32511101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University