View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20783_low_60 (Length: 310)

Name: NF20783_low_60
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20783_low_60
NF20783_low_60
[»] chr7 (2 HSPs)
chr7 (163-285)||(3064314-3064436)
chr7 (34-100)||(3064198-3064264)


Alignment Details
Target: chr7 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 163 - 285
Target Start/End: Original strand, 3064314 - 3064436
Alignment:
163 gataacttgtgatagatagatagaggaacagactcagtttcttcttagacttggatttcttttttgttcggcttttgctgcctccacccatgggaacgaa 262  Q
    |||||||| |||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
3064314 gataacttctgataggtagagacaggaacagactcagtttcttcttagacttggatttcttttttgttcggcttttgctgcctccacccatgggaacgaa 3064413  T
263 cgggaatggaaatttcaccctaa 285  Q
    |||||||||||||||||||||||    
3064414 cgggaatggaaatttcaccctaa 3064436  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 34 - 100
Target Start/End: Original strand, 3064198 - 3064264
Alignment:
34 tagttaaaattaaacacacctgacgataaatctgatcataaatatattgacgttcagaagatgctac 100  Q
    |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||    
3064198 tagttaaaattaaacacacctgacgataaatctgatcataaatagattgacgttcagaagatgctac 3064264  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University