View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_low_61 (Length: 304)
Name: NF20783_low_61
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_low_61 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 261; Significance: 1e-145; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 261; E-Value: 1e-145
Query Start/End: Original strand, 11 - 282
Target Start/End: Complemental strand, 42719768 - 42719496
Alignment:
| Q |
11 |
caaaggcaggtacggtgagtagtgatggggaaagcaaagagactgcaccaaagagagcagaagtaagcagcagagggtaaggtggtatggagagaaaggt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42719768 |
caaaggcaggtacggtgagtagtgatggggcaagcaaagagactgcaccaaagagagcagaagtaagcagcagagggtaaggtggtatggagagaaaggt |
42719669 |
T |
|
| Q |
111 |
attgtaggacccacttacaaaagataggtgacatcatcacagtgcctaaatggagaatttaggcca-tttgaaatcagaaatgaggaatcaattttctac |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42719668 |
attgtaggacccacttacaaaagataggtgacatcatcacagtgcctaaatggagaatttaggccattttgaaatcagaaatgaggaatcaattttctac |
42719569 |
T |
|
| Q |
210 |
tgttgggattctgcctgaagatttttcacaagggctcatcataatagacatgggaggaggtaaggcatgttcc |
282 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42719568 |
tgttgggattctgcctgaagatttttcacaagggctcatcataatagacatgggaggaggtaaggcatgttcc |
42719496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University