View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_low_81 (Length: 270)
Name: NF20783_low_81
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_low_81 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 1 - 257
Target Start/End: Complemental strand, 4244252 - 4243996
Alignment:
| Q |
1 |
ctagtttaaattcaagttaatctttgttgctgctggtaagttaatctttccatttgctcataggg-actattaaaagtttaaacttgtctcataatgctc |
99 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4244252 |
ctagtttaaattcaagttaatctttgttgctgttggtaagttaatctttccatttgctcataggggactattaaaagtttaaacttgtctcataatgctc |
4244153 |
T |
 |
| Q |
100 |
acttattatatcaaatgtccacttaacaaaaattatgttacttagacaagtagaagatttgagattcgaatcttaacccctcacatactaatatctatca |
199 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||||||| |||| ||||||| |||||||||||| ||||| || ||||| ||||||||||||||||| |
|
|
| T |
4244152 |
acttattatatcaaatgttcatttaacaaaaattatgttacgtagagaagtagaggatttgagattcaaatctcaa-ccctcgcatactaatatctatca |
4244054 |
T |
 |
| Q |
200 |
atcgagttacacttaattataaactttaaacgtgatttattttgataaaaactcacct |
257 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4244053 |
atcgagttacacttaattatagactttaaacgtgatttattttgataaaaacccacct |
4243996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University