View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_low_86 (Length: 260)
Name: NF20783_low_86
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_low_86 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 246
Target Start/End: Original strand, 41234756 - 41235002
Alignment:
| Q |
1 |
gtggccatagagcaagtcacaagagaccaaaactcatgtacaagttaccaaacatgaaaccaaagatgcatccatgccctatttgtggacttgagttttc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41234756 |
gtggccatagagcaagtcacaagagaccaaaactcatgtacaagttaccaaacatgaaaccaaagatgcatccatgccctatttgtggacttgagttttc |
41234855 |
T |
 |
| Q |
101 |
cattggacaagctcttggtggccacatgagaaagcataatagtagcttttccatcttc-nnnnnnnnnnnnnnnnccattgtgaaaggttgaatttttgc |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41234856 |
cattggacaagctcttggtggccacatgagaaagcataatagtagtttttccatcttcaaaaaatcaaaaaaagaccattgtgaaaggttgaatttttgc |
41234955 |
T |
 |
| Q |
200 |
ttggacttgaacttgacgccgttagagaatggtcttgtttggacttg |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41234956 |
ttggacttgaacttgacgccgttagagaatggtcttgtttggacttg |
41235002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University