View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20783_low_88 (Length: 254)
Name: NF20783_low_88
Description: NF20783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20783_low_88 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 40 - 249
Target Start/End: Complemental strand, 49922333 - 49922124
Alignment:
| Q |
40 |
ttcagcaccgcggtatgcttcattctgcctcttgtccaaggtgtcctatggaaaatgagaatattatgcattgtttccgggactgcgtttttgccaggca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49922333 |
ttcagcaccgcggtatgcttcattctgcctcttgtccaaggtgtcctatggaaaatgagaatattatgcattgtttccgggactgcgtttttgccaggca |
49922234 |
T |
|
| Q |
140 |
gttatggttgtctcttggatttgataacatcaannnnnnnatggagcagtcggtttcaacttggttacgtcggggtagtgaaagtgataacaaaagtttg |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49922233 |
gttatggttgtctcttggatttgataacatcaatttttttatggagcagtcggtttcatcttggttacgtcggggtagtgaaagtgataacaaaagtttg |
49922134 |
T |
|
| Q |
240 |
ttcatctcag |
249 |
Q |
| |
|
||||| |||| |
|
|
| T |
49922133 |
ttcatgtcag |
49922124 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 133; Significance: 3e-69; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 133; E-Value: 3e-69
Query Start/End: Original strand, 40 - 172
Target Start/End: Complemental strand, 28324687 - 28324555
Alignment:
| Q |
40 |
ttcagcaccgcggtatgcttcattctgcctcttgtccaaggtgtcctatggaaaatgagaatattatgcattgtttccgggactgcgtttttgccaggca |
139 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28324687 |
ttcagcaccgcggtatgcttcattctgcctcttgtccaaggtgtcctatggaaaatgagaatattatgcattgtttccgggactgcgtttttgccaggca |
28324588 |
T |
|
| Q |
140 |
gttatggttgtctcttggatttgataacatcaa |
172 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28324587 |
gttatggttgtctcttggatttgataacatcaa |
28324555 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University