View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20785_high_10 (Length: 243)
Name: NF20785_high_10
Description: NF20785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20785_high_10 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 157; Significance: 1e-83; HSPs: 6)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 37 - 205
Target Start/End: Complemental strand, 34705604 - 34705436
Alignment:
| Q |
37 |
cttatgttttatggtttattttgacgcttgaatgatctttgtgtaattgtcatttactctacggtttctgattgtaatatacgaacattgtagtgcttaa |
136 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34705604 |
cttatgttttatggtttattttgacacttgaatgatccttgtgtaattgtcatttactctaaggtttctgattgtaatatacgaacattgtagtgcttaa |
34705505 |
T |
 |
| Q |
137 |
tctgtaattaagttttggctttctttggtttgacatcatttaccaccaaaaatctattgtagttgcatt |
205 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34705504 |
tctgtaattaagttttggctttctttggtttgacatcatttaccaccaaaaatctattgtagttgcatt |
34705436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 196 - 242
Target Start/End: Complemental strand, 34704902 - 34704856
Alignment:
| Q |
196 |
tagttgcattgttattttaataaatttttattgtttttactctgtgc |
242 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34704902 |
tagttgcattgttattttaataaatttttattgtttttactctgtgc |
34704856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 2 - 38
Target Start/End: Original strand, 52126443 - 52126479
Alignment:
| Q |
2 |
aggaataaattttataacctgaaaacaaacaccccct |
38 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
52126443 |
aggaataaattttataacctggaaacaaacaccccct |
52126479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 18319640 - 18319605
Alignment:
| Q |
1 |
caggaataaattttataacctgaaaacaaacacccc |
36 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18319640 |
caggaataaattttataacctggaaacaaacacccc |
18319605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 40
Target Start/End: Complemental strand, 46920142 - 46920103
Alignment:
| Q |
1 |
caggaataaattttataacctgaaaacaaacaccccctta |
40 |
Q |
| |
|
||||||||||||||||||| || ||||||||||||||||| |
|
|
| T |
46920142 |
caggaataaattttataacatggaaacaaacaccccctta |
46920103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 5 - 38
Target Start/End: Original strand, 11031785 - 11031818
Alignment:
| Q |
5 |
aataaattttataacctgaaaacaaacaccccct |
38 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||| |
|
|
| T |
11031785 |
aataaattttataacctggaaacaaacaccccct |
11031818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 37; Significance: 0.000000000005; HSPs: 5)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 160 - 236
Target Start/End: Original strand, 18978098 - 18978174
Alignment:
| Q |
160 |
tttggtttgacatcatttaccaccaaaaatctattgtagttgcattgttattttaataaatttttattgtttttact |
236 |
Q |
| |
|
|||||||||||| || ||||||||||||| || ||||| |||||||||| |||||||| | |||| || |||||||| |
|
|
| T |
18978098 |
tttggtttgacaccacttaccaccaaaaacctcttgtacttgcattgttgttttaatagagttttcttatttttact |
18978174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 2 - 40
Target Start/End: Complemental strand, 54207271 - 54207233
Alignment:
| Q |
2 |
aggaataaattttataacctgaaaacaaacaccccctta |
40 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
54207271 |
aggaataaattttataacctggaaacaaacaccccctta |
54207233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 34967127 - 34967090
Alignment:
| Q |
1 |
caggaataaattttataacctgaaaacaaacaccccct |
38 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34967127 |
caggaataaattttataacctggaaacaaacaccccct |
34967090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 2 - 37
Target Start/End: Complemental strand, 9117478 - 9117443
Alignment:
| Q |
2 |
aggaataaattttataacctgaaaacaaacaccccc |
37 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||| |
|
|
| T |
9117478 |
aggaataaattttataacctggaaacaaacaccccc |
9117443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 4 - 36
Target Start/End: Original strand, 27742896 - 27742928
Alignment:
| Q |
4 |
gaataaattttataacctgaaaacaaacacccc |
36 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
27742896 |
gaataaattttataacctggaaacaaacacccc |
27742928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 1 - 35
Target Start/End: Complemental strand, 11465618 - 11465584
Alignment:
| Q |
1 |
caggaataaattttataacctgaaaacaaacaccc |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
11465618 |
caggaataaattttataacctgaaaacaaacaccc |
11465584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 1 - 36
Target Start/End: Complemental strand, 3428515 - 3428480
Alignment:
| Q |
1 |
caggaataaattttataacctgaaaacaaacacccc |
36 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3428515 |
caggaataaattttataacctggaaacaaacacccc |
3428480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 35; Significance: 0.00000000009; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 2 - 40
Target Start/End: Complemental strand, 38007034 - 38006996
Alignment:
| Q |
2 |
aggaataaattttataacctgaaaacaaacaccccctta |
40 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38007034 |
aggaataaattttataacctggaaacaaacaccccctta |
38006996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 2 - 38
Target Start/End: Complemental strand, 51083394 - 51083358
Alignment:
| Q |
2 |
aggaataaattttataacctgaaaacaaacaccccct |
38 |
Q |
| |
|
|||||||||||||||||| || ||||||||||||||| |
|
|
| T |
51083394 |
aggaataaattttataacttggaaacaaacaccccct |
51083358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 1 - 38
Target Start/End: Original strand, 16850099 - 16850136
Alignment:
| Q |
1 |
caggaataaattttataacctgaaaacaaacaccccct |
38 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
16850099 |
caggaataaattttataacctggaaacaaacaccccct |
16850136 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University