View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20785_high_12 (Length: 228)
Name: NF20785_high_12
Description: NF20785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20785_high_12 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 87; Significance: 7e-42; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 87; E-Value: 7e-42
Query Start/End: Original strand, 6 - 129
Target Start/End: Complemental strand, 44850768 - 44850635
Alignment:
| Q |
6 |
agaagaaactatttaaatgaagaaaaatgattcattgagttatagtagaatttcttatgatgctgaagtgagcgta----------aggcccatacatcc |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||| ||| |||||||||| |
|
|
| T |
44850768 |
agaagaaactatttaaatgaagaaaaatgattcgttgagttatagtagaatttcttatgatgctgaagtgagtgtatcatagccagaggtccatacatcc |
44850669 |
T |
 |
| Q |
96 |
tagtatgtattgacaagcattccgctcgaggaac |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
44850668 |
tagtatgtattgacaagcattccgctcgaggaac |
44850635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 179 - 228
Target Start/End: Complemental strand, 44850585 - 44850536
Alignment:
| Q |
179 |
tttgaagtctttcccctcaattaatccatctattaggacaaaatacgatt |
228 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
44850585 |
tttgaagtctttcccctcaattaatacatctattaggacaaaatacgatt |
44850536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University