View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20785_low_8 (Length: 279)
Name: NF20785_low_8
Description: NF20785
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20785_low_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 12 - 262
Target Start/End: Original strand, 43483284 - 43483532
Alignment:
| Q |
12 |
taacatgaaagagctaaatttttcaaatgcaaaaaggaatattatattatcatgttaatttataagagaaagtaacaaatttggaatcactatgcaataa |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||| ||||| ||||||||||||||||||| ||||||||||| |||| ||||||||| |
|
|
| T |
43483284 |
taacatgaaagagctaaatttttcaaatgcaaaaag-aatattatatcatcatattaatttataagagaaagttacaaatttggactcaccatgcaataa |
43483382 |
T |
|
| Q |
112 |
tgagcaaaggaaaaagaggtgtaccacgagtatcgtggatgaacttcttcatcctatacgtcatagttttgcaagtacccatgatttagagaagattaat |
211 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
43483383 |
tgagcaaagaaaaaagaggtgtaccacgagtatcgtggatgaacttcttcatcctatacgtcatagttttgcaagtacccatgatttagaaaagattaat |
43483482 |
T |
|
| Q |
212 |
ttacacagttgcacaatgaaatttgatatgaatttccagaaaccacccatc |
262 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43483483 |
ttacaca-ttgcacaatgaaatttgatatgaatttccagaaaccacccatc |
43483532 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University