View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20786_low_3 (Length: 238)
Name: NF20786_low_3
Description: NF20786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20786_low_3 |
 |  |
|
| [»] scaffold0251 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 17118622 - 17118838
Alignment:
| Q |
1 |
tcttcttgtggtgttatttgaccccttttgagatctggtcttagataattcacccacctcaatctacaactctttccattccttttcaatcctattcaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
17118622 |
tcttcttgtggtgttatttgaccccttttgagatctggtcttagataattcacccacctcaatctgcaactctttccattccttttcaatcctattcaaa |
17118721 |
T |
 |
| Q |
101 |
agaaaaacaataaattaagctacataacaaattgatcatagttgaagagtacaagttataatcaattttacttgttccattcctatcaaaattttaagaa |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17118722 |
ggaaaaacaataaattaagctacataacaaattgatcatatttgaagagtacaagttataagcaattttacttgttccattcctatcaaaattttaagat |
17118821 |
T |
 |
| Q |
201 |
aaggttgtgatagcaat |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
17118822 |
aaggttgtgatagcaat |
17118838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 1 - 93
Target Start/End: Original strand, 32447734 - 32447826
Alignment:
| Q |
1 |
tcttcttgtggtgttatttgaccccttttgagatctggtcttagataattcacccacctcaatctacaactctttccattccttttcaatcct |
93 |
Q |
| |
|
||||||||| ||||||| |||||| | ||||| ||||||||||| || |||||||| |||||||||||||| || ||||| ||| ||| |||| |
|
|
| T |
32447734 |
tcttcttgttgtgttatctgacccttcttgaggtctggtcttaggtagttcacccatctcaatctacaacttttcccatttcttctcagtcct |
32447826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0251 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0251
Description:
Target: scaffold0251; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 74
Target Start/End: Complemental strand, 9913 - 9879
Alignment:
| Q |
40 |
cttagataattcacccacctcaatctacaactctt |
74 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
9913 |
cttagataattcaaccacctcaatctacaactctt |
9879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 40 - 74
Target Start/End: Original strand, 262052 - 262086
Alignment:
| Q |
40 |
cttagataattcacccacctcaatctacaactctt |
74 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||| |
|
|
| T |
262052 |
cttagataattcagccacctcaatctacaactctt |
262086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 37 - 74
Target Start/End: Original strand, 237169 - 237206
Alignment:
| Q |
37 |
ggtcttagataattcacccacctcaatctacaactctt |
74 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
237169 |
ggtcttaaataattcagccacctcaatctacaactctt |
237206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University