View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_high_17 (Length: 349)
Name: NF20787_high_17
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_high_17 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 275; Significance: 1e-154; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 275; E-Value: 1e-154
Query Start/End: Original strand, 14 - 300
Target Start/End: Complemental strand, 44554087 - 44553801
Alignment:
| Q |
14 |
gaagcgaaaatggaaggacttttttgagagaataatgaagaaagtgaccgagaagcaagaggatttgcagaagagattcttggaggttattgagaaacgt |
113 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44554087 |
gaagcgaaaatggaagaacttttttgagagaataatgaagaaagtgaccgagaagcaagaggatttgcagaagagattcttggaggttattgagaaacgc |
44553988 |
T |
 |
| Q |
114 |
gagcaagaacgagttgttagagaagaagcgtggagagcacaagagatgcaaagaatcaatagagagagggaaatgcttgcacaagaaagatctataactg |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
44553987 |
gagcaagaacgagttgttagagaagaagcgtggagagcacaagagatgcaaagaatcaatagagagagggaaatgcttgcacacgaaagatctataactg |
44553888 |
T |
 |
| Q |
214 |
cagcaaaagatgctgcagtcatgtctttcttgcaaaaaatagccgaacaacaaaatctaggacaagcattacataacatcaacattg |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44553887 |
cagcaaaagatgctgcagtcatgtctttcttgcaaaaaatagccgaacaacaaaatctaggacaagcattacataacatcaacattg |
44553801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 21 - 266
Target Start/End: Original strand, 12682543 - 12682788
Alignment:
| Q |
21 |
aaatggaaggacttttttgagagaataatgaagaaagtgaccgagaagcaagaggatttgcagaagagattcttggaggttattgagaaacgtgagcaag |
120 |
Q |
| |
|
||||||||||| || ||||||||| |||||||| | || ||||| |||||||| || || |||||||||||||| | ||| |||||| | || || |
|
|
| T |
12682543 |
aaatggaaggatttctttgagagactaatgaaggaggttgttgagaaacaagaggagttacataagagattcttggaagctatagagaaaagagaaagag |
12682642 |
T |
 |
| Q |
121 |
aacgagttgttagagaagaagcgtggagagcacaagagatgcaaagaatcaatagagagagggaaatgcttgcacaagaaagatctataactgcagcaaa |
220 |
Q |
| |
|
| ||| || ||||||||||| ||||| |||||||||||||| || |||||||| |||||||| ||||| ||||| |||||| | |||| | || |
|
|
| T |
12682643 |
agagaggtgcaagagaagaagcttggaggttgcaagagatgcaaaggattaatagagaaagggaaattcttgctcaagagagatctcttgctgctactaa |
12682742 |
T |
 |
| Q |
221 |
agatgctgcagtcatgtctttcttgcaaaaaatagccgaacaacaa |
266 |
Q |
| |
|
||||||||| || ||| |||| ||||| || || || ||||||||| |
|
|
| T |
12682743 |
agatgctgctgttatggcttttttgcagaagattgctgaacaacaa |
12682788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University