View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_high_25 (Length: 290)
Name: NF20787_high_25
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_high_25 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 10200339 - 10200224
Alignment:
| Q |
1 |
ttattatcttcttctattcacccatataacttttaatttttgcgaaaatttcattaagtcctctcgactcttataacttcataaaatactttgaaatttt |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
10200339 |
ttattatcttcttctattcacccgtataacttttaatttttgcgaaaatttcattaagtcctctcaactcttataacttcataaaatactttgaaatttt |
10200240 |
T |
 |
| Q |
101 |
aagtttgtattatata |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
10200239 |
aagtttgtattatata |
10200224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 230 - 278
Target Start/End: Complemental strand, 10200098 - 10200050
Alignment:
| Q |
230 |
acagtctcctaaaatcttaattcaatacaatccataacttcatgatatt |
278 |
Q |
| |
|
|||||||||||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
10200098 |
acagtctcctaaaatcttaattcaatgcaccccataacttcatgatatt |
10200050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University