View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_high_27 (Length: 283)
Name: NF20787_high_27
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_high_27 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 87; Significance: 9e-42; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 148 - 266
Target Start/End: Complemental strand, 36875237 - 36875118
Alignment:
| Q |
148 |
cactccgggtactcttctctttgattgagaatgtatccatcctaaaatcactcattattgtgtcatattttcattcnnnnnnnaa-ccgtaaatgttaaa |
246 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || |||||||||||||| |
|
|
| T |
36875237 |
cactccgggtactctcctctttgattgagaatgtatccatcctaaaatcactcattattgtgtcatattttcattctttttttaacccgtaaatgttaaa |
36875138 |
T |
|
| Q |
247 |
aattaactgttatattaatt |
266 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
36875137 |
aattaactgttatattaatt |
36875118 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 10 - 43
Target Start/End: Complemental strand, 36875372 - 36875339
Alignment:
| Q |
10 |
ataatactaaagcaaatagggataaagagtgcga |
43 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||| |
|
|
| T |
36875372 |
ataatattaaagcaaatagggataaagagtgcga |
36875339 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University