View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_low_15 (Length: 356)
Name: NF20787_low_15
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_low_15 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 248; Significance: 1e-137; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 248; E-Value: 1e-137
Query Start/End: Original strand, 33 - 305
Target Start/End: Original strand, 8741318 - 8741590
Alignment:
| Q |
33 |
caataatatatgtatcacgggtagtagtagtattgacgtcaaagttat---tctatgtatttcagagttgaaccattcttcattatgcttgttattgtca |
129 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8741318 |
caataatatatgtatcacgggtagtagta---ttgacgtcaaagttattattctatgtatttcagagttgaaccattcttcattatgcttgttattgtca |
8741414 |
T |
|
| Q |
130 |
tttgtattattgtatttttattatttggaatcattgccgtggggagattgcttatagaatgtgactaccaggcttcacctgaaaagtgtatgagagtgac |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8741415 |
tttgtattattgtatttttattatttggaatcattgccgtggggagattgcttatagaatgtgactaccaggcttcacctgaaaagtgtatgagagtgac |
8741514 |
T |
|
| Q |
230 |
tccaaatgggcgaatctggaattttaaagattaaaaaataaaggttgtaatcggtgtgaaatacaaatatatcact |
305 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8741515 |
tccaaatgggcgaatctggaattttaaagattaaaaaataaaggttgtaatcggtgtgaaatacaaatatatcact |
8741590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University