View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_low_23 (Length: 297)
Name: NF20787_low_23
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_low_23 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 1 - 287
Target Start/End: Complemental strand, 32491302 - 32491016
Alignment:
| Q |
1 |
ttggtcgctctgattgcacttgtggaggaagaagatgattggaggtgcttggatgaagatcaaggtattttcacggcgaaagttgtttttcttttcttac |
100 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
32491302 |
ttggtcactctgattgcacttgtggaggaagaagatgattggaggtgcttggatgaagatcaaggtattttcacggtgaaagttgtttttcttttcttac |
32491203 |
T |
|
| Q |
101 |
ttgataaaaaagattattcttctttgggattaggaaagggggtggttttggagaagttatagaatagtcttgcttcatctaaagtgatcattttttcttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32491202 |
ttgataaaaaagattattcttctttgggattaggaaagggggtggttttgaagaagttatagaatagtcttgcttcatctaaagtgatcattttttcttg |
32491103 |
T |
|
| Q |
201 |
gaaaatgtgtttatgtcgtttgccaactaaagcgaaacattttaggagggaagtcttaggtggaggctaagatacctcttgtctgtg |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
32491102 |
gaaaatgtgtttatgtcgtttgccaactaaagtgaaacattttaggagggaagtcttaggtggaggctaagatacctcttgtgtgtg |
32491016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University