View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_low_27 (Length: 285)
Name: NF20787_low_27
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_low_27 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 82; Significance: 9e-39; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 82; E-Value: 9e-39
Query Start/End: Original strand, 148 - 268
Target Start/End: Complemental strand, 6848720 - 6848600
Alignment:
| Q |
148 |
tatgttctcactccatctgtttcaaaatgaacgtcactttatcaacnnnnnnnnngttttagaatgaaagtgatttgcgttctttaatgtaagattaact |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
6848720 |
tatgttctcactccatctgtttcaaaatgaacgtcactttatcaacagaaaaaaagtttcagaatgaaagtgatttgcgttctttaatgtaagattaatt |
6848621 |
T |
|
| Q |
248 |
ggtctgtaagattattgttgt |
268 |
Q |
| |
|
|||| |||||||||||||||| |
|
|
| T |
6848620 |
ggtcggtaagattattgttgt |
6848600 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 13 - 88
Target Start/End: Complemental strand, 6848855 - 6848780
Alignment:
| Q |
13 |
aatatgtcctgatcgatttgaagttgaatttgtaataagatgtgttcttattgttattgttattgcctttacctag |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6848855 |
aatatgtcctgatcgatttgaagttgaatttgtaataagatgtgttcttattgttattgttattgcctttacctag |
6848780 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University