View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_low_36 (Length: 243)
Name: NF20787_low_36
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_low_36 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 122; Significance: 1e-62; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 69 - 226
Target Start/End: Complemental strand, 3621107 - 3620950
Alignment:
| Q |
69 |
tgcattgtaatttggatcttatcttaatccaataactacatacgtgctaaatacctaaagtttttagagtaaaccattaaattgatccatgttttgtaat |
168 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||| ||||||||| ||| |
|
|
| T |
3621107 |
tgcattgtaatttggatcttatcttaattcaataactacatacgtgctaaatgcctaaagtttttaaagtaaatcattaaattgattcatgttttgcaat |
3621008 |
T |
|
| Q |
169 |
ctattttcatattaatcatgactctattaatgttacaaactagtctcaatttttatca |
226 |
Q |
| |
|
||||||||||||||||||||||||| ||||| |||||||||||||||| ||||||||| |
|
|
| T |
3621007 |
ctattttcatattaatcatgactctgttaatattacaaactagtctcagtttttatca |
3620950 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 1 - 39
Target Start/End: Complemental strand, 3621168 - 3621130
Alignment:
| Q |
1 |
ttaaatcaagatcaaatgatttaaatttcatatttttta |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3621168 |
ttaaatcaagatcaaatgatttaaatttcatatttttta |
3621130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University