View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_low_37 (Length: 242)
Name: NF20787_low_37
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_low_37 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 10200397 - 10200625
Alignment:
| Q |
1 |
tgttgtattggaatgttttctttttatttctggtcgatgagaagtatatcttagatgtgcctctcataatattttgaccatctcaaacattttgtacc-- |
98 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10200397 |
tgttgtattggaatgttttctttttattcctggtcgatgagaagtatatcttagatgtgcctctcataatattttgaccatctcaaacattttgtacctt |
10200496 |
T |
 |
| Q |
99 |
---------ctatggaagagtattggtttgttgcctatctttcttaaagattcatggaaaattcgacttctcactaatggaagaagaatacaa-cttttt |
188 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || |||||||||||| |||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10200497 |
acaaataccctatggaagagtattggtttgttgcctatcttttttgaagattcatggagaattcgacttctcactaatggaagaagaatacaaccttttt |
10200596 |
T |
 |
| Q |
189 |
tattttatgtctctccaacaataattttc |
217 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10200597 |
tattttatgtctctccaacaataattttc |
10200625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University