View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_low_42 (Length: 222)
Name: NF20787_low_42
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_low_42 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 10652623 - 10652828
Alignment:
| Q |
1 |
gtcatggtgaatctagaa---gcatttgtagaagcagtacaaggaagtggaactgaagttgaaaatcttgattttgaggaagaaagaagtgatggaaatg |
97 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10652623 |
gtcatggtgaatctagaagaagcatttgtagaagcagtacaaggaagtggaagtgaagttgaaaatcttgattttgaggaagaaagaagtgatggaaatg |
10652722 |
T |
|
| Q |
98 |
ctgagataccagaactcatcaatgtgttacaagccattcttgtcacacaaacaagtgttaagtgtctactagttttggaataatgttattatgtgaatga |
197 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10652723 |
ctgagatagcagaactcatcaatgtgttacaagccattcttgtcacacaaacaagtgttaagtgtctactagttttggaataatgttattatgtgaatga |
10652822 |
T |
|
| Q |
198 |
aatgaa |
203 |
Q |
| |
|
|||||| |
|
|
| T |
10652823 |
aatgaa |
10652828 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University