View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF20787_low_44 (Length: 213)

Name: NF20787_low_44
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF20787_low_44
NF20787_low_44
[»] chr8 (2 HSPs)
chr8 (19-110)||(43052326-43052417)
chr8 (157-198)||(43052453-43052494)


Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 43052326 - 43052417
Alignment:
19 aagtttaactctgtcgtcaatcataataaaatcttattgaatggcttgctaacaaaatgcattttcttgttccatggagatttattattagg 110  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||    
43052326 aagtttaactctgtcgtcaatcataataaaatcttattgaatggcttgcaaacaaaatgcattttcttgttccatggagatttattattagg 43052417  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 157 - 198
Target Start/End: Original strand, 43052453 - 43052494
Alignment:
157 tctaatgcagttgttgggaatttaatcataatgatcagtatt 198  Q
    |||||||||| |||| ||||||||||||||||||||||||||    
43052453 tctaatgcagatgttaggaatttaatcataatgatcagtatt 43052494  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University