View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20787_low_5 (Length: 493)
Name: NF20787_low_5
Description: NF20787
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20787_low_5 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 242; Significance: 1e-134; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 242; E-Value: 1e-134
Query Start/End: Original strand, 226 - 475
Target Start/End: Complemental strand, 12274059 - 12273810
Alignment:
| Q |
226 |
caatatatatctagttgtgttgcgtgtgtcgaagttatgttggtgtctgataccgacacatgttggatgttcatgacctctctttattaagccgaattat |
325 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274059 |
caatatatatctagttgtgtcgcgtgtgtcaaagttatgttggtgtctgataccgacacatgttggatgttcatgacctctctttattaagccgaattat |
12273960 |
T |
|
| Q |
326 |
cattgttatacatagcaactaacaagtgaaacttgttaatatcataaaaatcaagcttatcaatacaacaatatcttgaagcatatcataaaaattcaag |
425 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12273959 |
cattgttatacatagcaactaacaagtgaaacttgttaatatcataaaaatcaagcttatcaatacaacaatatcttgaagcatatcataaaaattcaag |
12273860 |
T |
|
| Q |
426 |
caatcatttgacacctaccagctgaagagtcccacttgcatggccagaag |
475 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12273859 |
caatcatttgacacctaccagctgaagagtcccacttgcatggccagaag |
12273810 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 7 - 128
Target Start/End: Complemental strand, 12274276 - 12274155
Alignment:
| Q |
7 |
tcgaagaatatgagtctctctggtggacaccaacggagaaagaacttggaattctgcgtgcatctgttcgcaaaaatatgcaatatgttagtgttcattc |
106 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12274276 |
tcgaagaaaatgagtctctctggtggacaccaacggagaaagaacttggaattctgcgtgcatctgttcgcaaaaatatgcaatatgttagtgttcattc |
12274177 |
T |
|
| Q |
107 |
aatattcaaatagcaactttag |
128 |
Q |
| |
|
|||||||||||||||| ||||| |
|
|
| T |
12274176 |
aatattcaaatagcaattttag |
12274155 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University