View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20788_high_3 (Length: 357)
Name: NF20788_high_3
Description: NF20788
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20788_high_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 208; Significance: 1e-114; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 208; E-Value: 1e-114
Query Start/End: Original strand, 12 - 235
Target Start/End: Complemental strand, 14854662 - 14854439
Alignment:
| Q |
12 |
atgagatggacatcatcagggattaagagagaatcaacggtgaagatagtgagattgtagggtaacattttgagctgtgaaagcacggtggcgtttgagg |
111 |
Q |
| |
|
||||||| || | ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14854662 |
atgagatcgaaaccataagggattaagagagaatcaacggtgaagatagtgagattgtagggtaacattttgagctgtgaaagcacggtggcgtttgagg |
14854563 |
T |
|
| Q |
112 |
atgagtaaggtgctggggaatggattgtaacagtgttagtgttcggggagtgggtgatattaacggagccgaagttgttggtggcgcggccggtggtttg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14854562 |
atgagtaaggtgctggggaatggattgtaacagtgttagtgttcggggagtgggtgatattaacggagccgaagttgttggtggcgcggccggtggtttg |
14854463 |
T |
|
| Q |
212 |
gaagagagtggtgacgagtttacc |
235 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
14854462 |
gaagagagtggtgacgagtttacc |
14854439 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 303 - 350
Target Start/End: Complemental strand, 14854371 - 14854324
Alignment:
| Q |
303 |
tcggcgagagcggagggggagaggttatggaggtgagggtctgtggtg |
350 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
14854371 |
tcggcgagggcggagggggagaggttatggaggtgagggtcggtggtg |
14854324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University