View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20789_low_3 (Length: 457)
Name: NF20789_low_3
Description: NF20789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20789_low_3 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 274; Significance: 1e-153; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 274; E-Value: 1e-153
Query Start/End: Original strand, 128 - 445
Target Start/End: Original strand, 35473084 - 35473401
Alignment:
| Q |
128 |
tacttggaccttgtcaattactattatttttgcgtgtgcttttttaatattcattattttgatggccagaattttcccctattccatctctgggtgttaa |
227 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
35473084 |
tacttggaccttgtcaatttctattatttttgcgtgtgcttttttaatattcattattttgatggccagaatcttcccctattccatctctgggtgttaa |
35473183 |
T |
 |
| Q |
228 |
cttaagtaaagattgcatgcaaatcttatgatcaactcnnnnnnnnnnnnggatgtgaatatgtgaccattagttagttagatctgatttctatttttgg |
327 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473184 |
cttaagtaaagattgcatgcaaatcttatgatcaactcttttttatttttggatgtgaatatgtgaccattagttagttagatctgatttctatttttgg |
35473283 |
T |
 |
| Q |
328 |
tattattcacattgaccaagactctttgtttagatattgcttctaaccaaatgatcattttgttaaacaaagttgatttaaatttaatgctcaattagat |
427 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35473284 |
tattattcacattgaccaagactctttgtttagatattgcttctaaccaaatgatcattttgttaaacaaagttgatttaaatttaatgctcaattagat |
35473383 |
T |
 |
| Q |
428 |
gtttcacctgaatatctc |
445 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
35473384 |
gtttcacctgaatatctc |
35473401 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 70; E-Value: 2e-31
Query Start/End: Original strand, 19 - 88
Target Start/End: Original strand, 35472973 - 35473042
Alignment:
| Q |
19 |
tgaacccaccactatatataatctccttcaaccttctctgttctgcgtaggatcataccccccaacttat |
88 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35472973 |
tgaacccaccactatatataatctccttcaaccttctctgttctgcgtaggatcataccccccaacttat |
35473042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University