View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2078_low_17 (Length: 227)
Name: NF2078_low_17
Description: NF2078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2078_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 169; Significance: 9e-91; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 169; E-Value: 9e-91
Query Start/End: Original strand, 23 - 214
Target Start/End: Complemental strand, 4960789 - 4960600
Alignment:
| Q |
23 |
ataaaatgtgttaccccaaaacccttctttcccttaaaaaacacgctgtatcacacattttgggagtgtttccaatgtcttggatgctatgcattttgtt |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
4960789 |
ataaaatgtgttaccccaaaacccttctttcccttaaaaaacacgttgtatcaca--ttttgggagtgtttccaatgtcttggatgcaatgcattttgtt |
4960692 |
T |
 |
| Q |
123 |
tgcttttcatctttggaacctcactgtgtgttacttataaatttgtgattatctctctaattctctagaaaatgtgtaatggtctgtgctcc |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
4960691 |
tgcttttcatctttggaacctcactgtgtgttacttataaatttgtgattatctctctaattctctagaaaatgtgtaatggtctctgctcc |
4960600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University