View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2078_low_9 (Length: 250)
Name: NF2078_low_9
Description: NF2078
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2078_low_9 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 10 - 250
Target Start/End: Original strand, 8061154 - 8061389
Alignment:
| Q |
10 |
aagaatatgaacgttatatatacctttaacatggtgtgatctaacggtggcatgaactgcgtaaccatgttgaagaagcttcataatcagccatgatgcc |
109 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8061154 |
aagaaaatgaacgttatatatacctttaacatggtgtgatctaacggtggcatgaactgcgtaaccatgttgaagaagcttcataatcagccatgatgcc |
8061253 |
T |
 |
| Q |
110 |
acataccccgttgctcctgtcacacaaattgtacctttatcgttttccatttctctcttcctatttcaatctctatcttctctcaaggtaggaaatattt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8061254 |
acataccccgttgctcctgtcacacaaattgtacctttatcgttttccatttctctcttcctatttcaatctctatcttctctcaaggtaggaaatattt |
8061353 |
T |
 |
| Q |
210 |
atacacaagttcaatacaatataatgatgttaattattagc |
250 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
8061354 |
atacataagttcaatac-----aatgatgttaattattagc |
8061389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University