View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20790_high_11 (Length: 329)
Name: NF20790_high_11
Description: NF20790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20790_high_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 30 - 317
Target Start/End: Original strand, 2178421 - 2178698
Alignment:
| Q |
30 |
caacttaattcattcgccatgcaattaagtctagtgtgatggcatagctactttgaggctatctcacacaactatcatgcacacgtctattaatcgaata |
129 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2178421 |
caacttaattcattcgccatgcaattaagtctagtgtgatggcatagctactttgaggctatctcacacaactatcatgcacacgtctattaatcgaata |
2178520 |
T |
 |
| Q |
130 |
taaactcatgtgtcatgtcgtgttagtgtcggacataattagatatgtatttgatcgcaagtaaataacaagtaaataaaccatgtagtaattatttaag |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2178521 |
taaactcatgtgtcatgtcgtgttagtgtcggac---attagatatgtatttgatcgcaagtaaa-------taaataaaccatgtagtaattatttaag |
2178610 |
T |
 |
| Q |
230 |
aaatgtatcttcttgaaattcttgaagattagaaggtatgcaatgatagattgaaagtgcacccaagacgactagatattcatatatt |
317 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2178611 |
aaatgtatcttcttgaaattctagaagattagaaggtatgcaatgatagattgaaagtgcacccaagacgactagatattcatatatt |
2178698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University