View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20790_high_12 (Length: 282)
Name: NF20790_high_12
Description: NF20790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20790_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 270
Target Start/End: Complemental strand, 36170879 - 36170611
Alignment:
| Q |
1 |
ctcataatgtgatttgaaatccatgttaactagtggttaaaacatttttgtttgacagatcgttcggcatgttgagagttggaatgtttctgcacttgaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36170879 |
ctcataatgtgatttgaaatccatgtcaactagtggttaaaacatttttgtttgacagatcgttcggcatgttgagagttggaatgtttctgcacttgaa |
36170780 |
T |
 |
| Q |
101 |
gcagttttgcagattttcaagtttgaaaaaccaggtggttgaatgtcatggcgggtgagggcatcacttagtaacatgtttccatgaaaatgccaacgat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
36170779 |
gcagttttgcagattttcaagtttgaaaaaccaggtggttgaatgtcatggcgggtgagggcgtcacttagtaacatgtttccatgaaaatgccaatgat |
36170680 |
T |
 |
| Q |
201 |
tcttaatttatttagnnnnnnnnnncctactgtatatagttggtaatgatgcaattggcgcctgtatatt |
270 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
36170679 |
tcttaatttatatag-tttttttttcctactgtatatagttggtaatgacgcaattggcgcctgtatatt |
36170611 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University