View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF20790_low_18 (Length: 206)
Name: NF20790_low_18
Description: NF20790
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF20790_low_18 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 84; Significance: 4e-40; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 84; E-Value: 4e-40
Query Start/End: Original strand, 68 - 187
Target Start/End: Complemental strand, 32492504 - 32492374
Alignment:
| Q |
68 |
tatatattctacatgcattaatcgatcaataagtcccatgcacttcaataaaatatacagaacttctatgtagtgac------tcttattatgaatg--- |
158 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32492504 |
tatatattctacatgcattaatcgatcaataagtcccatgcacttcaataaaatatacagaacttctatgtagtgactctttgtcttattatgaatgtca |
32492405 |
T |
|
| Q |
159 |
--tcacaccacattggtaaaatgagttgtgt |
187 |
Q |
| |
|
|||||||||||| |||||||||||||||| |
|
|
| T |
32492404 |
catcacaccacattagtaaaatgagttgtgt |
32492374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 15 - 47
Target Start/End: Complemental strand, 32492529 - 32492497
Alignment:
| Q |
15 |
caaaggtgcttgcttggtcgtatcgtatatatt |
47 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
32492529 |
caaaggtgcttgcttggtcgtatcgtatatatt |
32492497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University